FastQCFastQC Report
Wed 7 Dec 2016
nfu_skin_mzm_27_JM73_5_TCATTC_L005_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_27_JM73_5_TCATTC_L005_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11293782
Sequences flagged as poor quality0
Sequence length8-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT9268818.207002756029823No Hit
AACATTCAACGCTGTCGGTGAGT4678894.142890309021372No Hit
TTCCCTTTGTCATCCTATGCCT4645974.113741526089312No Hit
AACATTCAACGCTGTCGGTGAG4489123.974859794531185No Hit
TACCCTGTAGAACCGAATTTGT3342682.959752543479235No Hit
TCCTTCATTCCACCGGAGTCTG2912932.579233422426606No Hit
TAGCTTATCAGACTGGTGTTGGC2725602.413363388809878No Hit
TGAGGTAGTAGGTTGTATAGTT2674792.3683740309490657No Hit
AAGCTGCCAGCTGAAGAACTGT2577842.282530333948362No Hit
TACCCTGTAGAACCGAATTTGC2191361.940324330680369No Hit
CCTGTCTGAGGGTCGCT1997531.7686989176876267No Hit
AACAGTAAGAGTTTATGTGCTG1976661.7502197226757166No Hit
TATTGCACTTGTCCCGGCCTGT1835081.6248587054363188No Hit
TACCCTGTAGAACCGAATTTGCG1568061.388427720669657No Hit
AACATTCAACGCTGTCGGTGA1435591.2711330889864882No Hit
TTGGTCCCCTTCAACCAGCTGT1352891.1979069544639696No Hit
TCCTTCATTCCACCGGAGTCTGT1203591.0657103174118288No Hit
TAACGGAACCCATAATGCAGCTG1095310.9698345514372422No Hit
ACAGTAGTCTGCACATTGGTT1010710.8949260752509656No Hit
TTTGGTCCCCTTCAACCAGCTGT956930.8473069517368053No Hit
TTCACAGTGGCTAAGTTCTG928180.8218504660352042No Hit
TTCCCTTTGTCATCCTATGCCTG743540.6583622740371649No Hit
TTCACAGTGGTTAAGTTCTG703620.6230153902386287No Hit
TTCAAGTAATCCAGGATAGGC685100.606616986231893No Hit
AAGCTGCCAGCTGAAGAACT670060.593299923798777No Hit
ACCCTGTAGAACCGAATTTGCG590390.5227566815084619No Hit
TTCACAGTGGCTAAGTTCTGC564740.500045069047729No Hit
TTCAAGTAATCCAGGATAGGTT553030.4896765317410944No Hit
TGAGGTAGTAGGTTGTATAGT546430.48383260806698764No Hit
CTACGCCTGTCTGAGGGTCGCT502390.44483769918703936No Hit
CTGTCTGAGGGTCGCT495180.43845365529456826No Hit
TGAGGTAGTAGTTTGTATAGTT460430.40768451170741565No Hit
TTCAAGTAATCCAGGATAGGCTT445240.394234632827161No Hit
TACCCTGTAGAACCGAATTTG427360.37840291232821743No Hit
AAGCTGCCAGCTGAAGAACTGC420910.3726918051012495No Hit
TACCCTGTAGATCCGGATTTGT402490.3563819453926063No Hit
TTCCAGTGATGACAGCCTATAATCTGACT395200.3499270660616612No Hit
CACCACGTTCCCGTGG394990.3497411230356669No Hit
TATTGCACTTGTCCCGGCCTGTT388240.3437643829144214No Hit
TTCACAGTGGCTAAGTTCAGT370150.3277467193894835No Hit
CCACGTTCCCGTGG349350.30932950538623816No Hit
CATTGCACTTGTCTCGGTCTGA349270.3092586699477642No Hit
TGTCTGAGGGTCGCT343520.304167372807444No Hit
TGAGATGAAGCACTGTAGCTCT331510.29353320260653165No Hit
TCCTTCATTCCACCGGAGTCT326810.28937162059618293No Hit
AACATTCATTGCTGTCGGTGGGT304810.2698918750158273No Hit
TGAGGTAGTAGGTTGTATAGTTT302120.26751003339713836No Hit
CCTTTCTGAGGGTCGCT294390.2606655591545861No Hit
TCCAGTGATGACAGCCTATAATCTGACT287950.2549633063574275No Hit
ACAGTAGTCTGCACATTGGTTA285430.25273199004549585No Hit
TAGCTTATCAGACTGGTGTTGG280660.24850842702648238No Hit
TCCAGCATCAGTGATTTTGTT276110.24447966146327244No Hit
TATTGCACTTGTCCCGGCCTGTAT266110.23562523165401986No Hit
TGAGATGAAGCACTGTAGCTC261830.2318355356956598No Hit
AACATTCATTGCTGTCGGTGGG255180.2259473398725068No Hit
TATTGCACTTGTCCCGGCCTGTA251450.22264463755365563No Hit
AACTCCAGTCACTCATTCATCT251420.22261807426422786RNA PCR Primer, Index 45 (100% over 22bp)
TTCAAGTAATCCAGGATGGGCT250740.2220159730371987No Hit
TGAGGTAGTAGATTGAATAGTT245080.21700436576516177No Hit
AACTCCAGTCACTCATTCATCTCGTATGC239210.2118068154671305RNA PCR Primer, Index 45 (100% over 29bp)
TACAGTAGTCTGCACATTGGTT235900.20887599920026792No Hit
AACATTCAACGCTGTCGGTGG233630.2068660436335676No Hit
TTTGGTCCCCTTCAACCAGCTG231480.20496234122457826No Hit
TACCCTGTAGAACCGAATGTGT229310.20304092995597048No Hit
AACATTCAACGCTGTCGGTGAGA224200.1985163163234424No Hit
TATTGCACTTGTCCCGGCCTGTTT213770.189281146032392No Hit
ACCCTGTAGAACCGAATTTGC213320.18888269669097563No Hit
TTCACAGTGGCTAAGTTCTGCT206100.18248979836869528No Hit
TTCACAGTGGTTAAGTTCTGCC203400.18009910232019707No Hit
TTCAGTCATTGTTTCTGGTTGT198510.1757692861434726No Hit
ACCACGTTCCCGTGG184650.16349704642784854No Hit
TTGTTCCCCTTCAACCAGCTGT184560.16341735655956527No Hit
AACTCCAGTCACTCATTCATCTCG175140.15507648367924934RNA PCR Primer, Index 45 (100% over 24bp)
TTCACAGTGGTTAAGTTCTGC168420.14912630684743164No Hit
ACCCTGTAGAACCGAATTTGTG167980.14873671193582452No Hit
TCCAGCATCAGTGATTTTGTTG166210.1471694778595868No Hit
TCCCTGAGACCCTTAACCTGTGA162740.14409699071577617No Hit
TCCCTGAGACCCTTAACCTGTG162600.14397302869844664No Hit
TGAGAACTGAATTCCATAGATGG162140.14356572492722103No Hit
CCCTGAGACCCTTAACCTGTGA159720.1414229529133819No Hit
TATGTGCCCTTGGACTACATCG155330.13753585822712No Hit
CATTATTACTTTTGGTACGCG146640.12984135872287955No Hit
TGATGTAGTAGGTTGTATAGTT146490.12970854227574075No Hit
AACCCGTAGATCCGAACTTGTG144290.1277605677177052No Hit
TGAGGTAGTTGGTTGTATAGTT143230.12682199815792441No Hit
AACATTCAACGCTGTCGGTG142500.126175624781849No Hit
TGGACGGAGAACTGATAAGGGC142120.12583915644909738No Hit
TTCAAGTAATCCAGGATAGGCA141740.1255026881163458No Hit
TGTAAACATCCTTGACTGGAAGCT139900.12387347303144333No Hit
ACATTAGTCTGCACATTGGTT139480.12350158697945471No Hit
TGAGATGAAGCACTGTAGCT139160.12321824522555863No Hit
TACCCTGTAGATCCGGATTTGTG138370.12251874527062767No Hit
ATGACCTATGAATTGACAGCC136990.12129683395695082No Hit
TTCACAGTGGTTAAGTTCTGCCT133690.11837487211989747No Hit
ACCCTGTAGAACCGAATTTGT133080.11783475190153307No Hit
TGTAAACATCCTACACTCTCAGCT132190.1170467076485096No Hit
TTATGTAGTAGGTTGTATAGTT129870.114992479932763No Hit
AACATTCAACGCTGTCGGTGT129360.11454090401249112No Hit
AATGACACGTTTTCTCCCGGATT129190.11439037870573383No Hit
AGCTACATCTGGCTACTGGGTCTC127840.11319503068148472No Hit
TTCCCTTTGTCATCCTATGCC127690.11306221423434595No Hit
TGAGGTAGTAGTTTGTGCTGTT127290.11270803704197584No Hit
TGTAAACATCCCCGACTGGAAGCT125240.11089287893107908No Hit
CACGTTCCCGTGG124000.10979492963473175No Hit
TACCCTGTAGAACCGAATTTGTG121940.10797091709402573No Hit
TATTGCACTTGTCCCGGCCTGTAA120620.10680213235920437No Hit
TACAGTACTGTGATAACTGAAG120440.10664275262263784No Hit
AACTCCAGTCACTCATTCATCTC119690.10597867038694389RNA PCR Primer, Index 45 (100% over 23bp)
TGTAAACATCCCCGACTGGA116940.10354370218939944No Hit
CTGGACAACTCTTAGCGG115270.10206501241125426No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TGCTATT50.0048536841298.576323
TTCGCAC50.0048536841298.576323
TAACTAA1000.01298.576323
CGTATGC26450.01269.118923
TAACTGC2000.01136.254323
GATTCCT6150.0981.8503423
CAACCCG550.0944.4190723
AATAACC750.0865.717523
AAATAGC600.0865.7174723
TAACACA153.3573462E-5865.7174723
ATAACTA10300.0686.3650522
TCGTATG27600.0684.3236722
GTATGCC800.0649.2881523
ACAACCC3000.0633.09522
TCTGACT82600.0625.7062423
ATCACTA450.0625.27922
GGATTCC7800.0568.162222
TAAAAAA601.4551915E-11541.073423
ATACGTG251.4551915E-11535.52421
GACAACC4600.0500.5984821