FastQCFastQC Report
Wed 7 Dec 2016
nfu_skin_mzm_39_JM13_5_TCGAAG_L004_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_39_JM13_5_TCGAAG_L004_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10153212
Sequences flagged as poor quality0
Sequence length8-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCCCTTTGTCATCCTATGCCT8258698.134066342749467No Hit
TTCAAGTAATCCAGGATAGGCT8118877.996356226975267No Hit
AACATTCAACGCTGTCGGTGAG5384075.302824367303667No Hit
AACATTCAACGCTGTCGGTGAGT3667943.6125907742298695No Hit
TACCCTGTAGAACCGAATTTGT3342773.292327590520123No Hit
TAGCTTATCAGACTGGTGTTGGC2773702.731844858553136No Hit
TCCTTCATTCCACCGGAGTCTG2672702.6323689488607154No Hit
TACCCTGTAGAACCGAATTTGC2515862.4778956649383463No Hit
TACCCTGTAGAACCGAATTTGCG1778221.7513866547847126No Hit
AAGCTGCCAGCTGAAGAACTGT1670361.6451542625131832No Hit
AACAGTAAGAGTTTATGTGCTG1515921.4930447625835055No Hit
CCACGTTCCCGTGG1181731.1638976907012284No Hit
TAACGGAACCCATAATGCAGCTG1098251.0816774041554535No Hit
TTCACAGTGGTTAAGTTCTG1091591.0751179035757354No Hit
TGAGGTAGTAGGTTGTATAGTT1072411.0562273298341451No Hit
AACATTCAACGCTGTCGGTGA994870.9798574086702809No Hit
TTCACAGTGGCTAAGTTCTG964370.9498176537631637No Hit
TCCTTCATTCCACCGGAGTCTGT880750.8674594798178152No Hit
TATTGCACTTGTCCCGGCCTGT764050.7525204831732066No Hit
TACCCTGTAGATCCGGATTTGT757300.7458723406937627No Hit
ACCCTGTAGAACCGAATTTGCG649810.6400043651211065No Hit
TTCAAGTAATCCAGGATAGGC611160.601937593738809No Hit
AAGCTGCCAGCTGAAGAACT484300.476991911525141No Hit
TTCAAGTAATCCAGGATAGGTT434770.4282093193759768No Hit
TCCTTCATTCCACCGGAGTCT414510.4082550428376754No Hit
ACAGTAGTCTGCACATTGGTT399150.39312682528445186No Hit
TTCACAGTGGCTAAGTTCTGC390320.3844300700113422No Hit
AACTCCAGTCACTCGAAGATCTCGTATGC380920.37517191603996847RNA PCR Primer, Index 47 (100% over 29bp)
TTGGTCCCCTTCAACCAGCTGT368530.3629688811777002No Hit
TTCCAGTGATGACAGCCTATAATCTGACT357940.3525386843099504No Hit
TACCCTGTAGAACCGAATTTG346680.3414485977442409No Hit
TTCAAGTAATCCAGGATAGGCTT320760.3159197306231762No Hit
CCTGTCTGAGGGTCGCT320150.31531893552503387No Hit
TGAGAACTGAATTCCATAGATGG296300.29182883209766525No Hit
TAGCTTATCAGACTGGTGTTGG289880.28550570991721635No Hit
TGAGGTAGTAGGTTGTATAGT281690.2774392970421577No Hit
CATTGCACTTGTCTCGGTCTGA270560.26647724877605233No Hit
TTCACGTAATCCAGGATAGGCT264840.26084356359347166No Hit
AAGCTGCCAGCTGAAGAACTGC261460.25751456780376497No Hit
ACCCTGTAGAACCGAATTTGC259440.25552504960991657No Hit
TTCACAGTGGCTAAGTTCAGT250300.24652297223775096No Hit
TACCCTGTAGAACCGAATGTGT241960.2383088228631491No Hit
AACATTCAACGCTGTCGGTGAGA229250.2257906168018554No Hit
TTTGGTCCCCTTCAACCAGCTGT212330.2091259396533826No Hit
AACATTAAGAGTTTATGTGCTG209490.20632879526203138No Hit
TTCACAGTGGTTAAGTTCTGCC208420.2052749415652899No Hit
TTCAGTCATTGTTTCTGGTTGT206320.20320663057168512No Hit
TTAGGTAGTAGGTTGTATAGTT203040.1999761257816738No Hit
TGAGATGAAGCACTGTAGCTCT197880.1948939901973878No Hit
TATTGCACTTGTCCCGGCCTGTT195200.1922544314055493No Hit
TCCAGTGATGACAGCCTATAATCTGACT189850.18698516292184186No Hit
CACCACGTTCCCGTGG188380.1855373452263185No Hit
TTCACAGTGGTTAAGTTCTGCCT185490.18269095533511956No Hit
TTTCCTTTGTCATCCTATGCCT184840.18205076383709906No Hit
TGAGATGAAGCACTGTAGCTC181360.17862327704769682No Hit
TGAGATGAAGCACTGTAGCT179150.17644662595442703No Hit
TTCACAGTGGCTAAGTTCTGCT178170.17548141415741145No Hit
TTCCATTTGTCATCCTATGCCT169480.16692254628387548No Hit
AACATTCATTGCTGTCGGTGGG165870.16336702119486918No Hit
TTCCCTTTGTCATCCTATGCCTG164070.1615941832003508No Hit
CATTATTACTTTTGGTACGCG163100.16063882050330477No Hit
TCCAGCATCAGTGATTTTGTT162940.160481234903792No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT160780.15835382931036995No Hit
AACATTCAACGCTGTCGGTGG158790.1563938584164302No Hit
TGGACGGAGAACTGATAAGGGC158160.15577336511834874No Hit
TGAGGTAGTAGTTTGTATAGTT156660.15429600012291678No Hit
TGAGGTAGTAGGTTGTATAGTTT153720.15140036473187007No Hit
ACCCTGTAGAACCGAATTTGT152890.1505828894343977No Hit
TTCACAGTGGTTAAGTTCTGC152880.15057304033442817No Hit
CCACTTTCCCGTGG152240.14994269793637718No Hit
AACATTCAACGCTGTCGGTGT151910.14961767763738215No Hit
TTTAAGTAATCCAGGATAGGCT151190.1489085424395748No Hit
TCAGTAACTGGAATCTGTCCCT150510.14823880364164563No Hit
CTGGACAACTCTTAGCGG147300.14507724255142115No Hit
AACTCCAGTCACTCGAAGATCT144820.1426346657589736RNA PCR Primer, Index 47 (100% over 22bp)
TTCCCTTTGTCATCCTATGCC144570.14238843825973493No Hit
TATGTGCCCTTGGACTACATCG138490.1364001854782506No Hit
TAACTGAACCCATAATGCAGCTG137560.13548421918108278No Hit
AACATTCATTGCTGTCGGTGGGT135780.1337310793865035No Hit
TGAAATGTTTAGGACCACTTGT134750.13271662208964022No Hit
TTCAAGTAATCCAGGATGGGCT131740.1297520429988067No Hit
TATTGCACTTGTCCCGGCCTGTA128920.12697459680739456No Hit
ACCCTGTAGAACCGAATTTGTG128530.12659048190858224No Hit
TTCAAGTAATCCAGGATAGGCA127630.12570406291132302No Hit
ACAGTAGTCTGCACATTGGTTA123580.12171517742365666No Hit
TACCCTGTAGATCCGGATTTGTG117090.11532311154342093No Hit
TAACACTGTCTGGTAACGATG114580.11285098745106474No Hit
TATTGCACTTGTCCCGGCCTGTAT113720.11200396485368375No Hit
CTTCCCTTTGTCATCCTATGCCT110780.10910832946263704No Hit
TGTAAACATCCTACACTCTCAGCT109400.10774915366683963No Hit
CTCGGTTCTGGTGTCAAGCGCCCGGC103190.10163286258575117No Hit
AATGACACGTTTTCTCCCGGATT102140.10059870708894879No Hit
TCCCTGAGACCCTTAACCTGTG101610.10007670479056283No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AGTATGC50.007899161017.8711523
CCCCAAG50.007899161017.8711523
CCCGATG50.007899161017.8711523
CGTATGC43600.0971.179923
GATTCCT19750.0927.6800523
TAACTGC1750.0697.968823
AAATAGC3100.0689.525723
ATAACTA6750.0583.9783322
TCTGACT66700.0579.133623
AATAACC451.0913936E-11565.48423
TCGTATG44550.0563.7348622
GGATTCC24400.0551.967222
GCTGAGC1700.0538.87323
TAACTAA404.0545274E-9508.9355823
CCGGCGA750.0477.8004822
GAAAATA2200.0471.8918521
GCATAGC1150.0467.413522
CATAGCT553.6379788E-11462.668723
CTCGTAT47900.0442.2432321
TTCTCGC10650.0439.6439223