FastQCFastQC Report
Wed 7 Dec 2016
nfu_skin_mzm_39_JM15_5_TCGGCA_L006_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_39_JM15_5_TCGGCA_L006_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences36298333
Sequences flagged as poor quality0
Sequence length8-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT27616637.608236444356825No Hit
TTCCCTTTGTCATCCTATGCCT16180104.457532526355963No Hit
AACATTCAACGCTGTCGGTGAGT12403673.41714590584642No Hit
AACATTCAACGCTGTCGGTGAG12090533.330877481343289No Hit
TAGCTTATCAGACTGGTGTTGGC7682302.116433280834136No Hit
AAGCTGCCAGCTGAAGAACTGT7027941.9361605393834476No Hit
TCCTTCATTCCACCGGAGTCTG6943831.9129886763670385No Hit
TGAGGTAGTAGGTTGTATAGTT6769741.8650277961800614No Hit
TACCCTGTAGAACCGAATTTGT6414531.7671693077475488No Hit
AACAGTAAGAGTTTATGTGCTG5905701.6269893165617273No Hit
TACCCTGTAGAACCGAATTTGC5316581.464689852286054No Hit
CCACGTTCCCGTGG4550921.2537545456977321No Hit
TATTGCACTTGTCCCGGCCTGT4505621.2412746337414449No Hit
TAACGGAACCCATAATGCAGCTG4481511.23463245543535No Hit
AACATTCAACGCTGTCGGTGA4040001.112998770494502No Hit
CCTGTCTGAGGGTCGCT3760151.0359015660581439No Hit
TCCTTCATTCCACCGGAGTCTGT3750111.0331355988166178No Hit
TACCCTGTAGAACCGAATTTGCG3683791.014864787316817No Hit
TTGGTCCCCTTCAACCAGCTGT3286660.9054575591666978No Hit
TTCACAGTGGCTAAGTTCTG2654390.7312704966368566No Hit
ACAGTAGTCTGCACATTGGTT2552000.703062589678705No Hit
TTCACAGTGGTTAAGTTCTG2528710.6966463170636513No Hit
TTTGGTCCCCTTCAACCAGCTGT2210040.60885440661972No Hit
TTCAAGTAATCCAGGATAGGC2023430.5574443322231906No Hit
AAGCTGCCAGCTGAAGAACT1935360.5331815100159008No Hit
TGAGGTAGTAGGTTGTATAGT1673690.461092800046768No Hit
TTCACAGTGGCTAAGTTCTGC1642370.45246430462798387No Hit
TACCCTGTAGATCCGGATTTGT1605930.4424252761139196No Hit
TTCAAGTAATCCAGGATAGGTT1554300.4282014824206941No Hit
TTCAAGTAATCCAGGATAGGCTT1526990.4206777209300493No Hit
TTCCAGTGATGACAGCCTATAATCTGACT1509140.41576013972873077No Hit
TTCACAGTGGCTAAGTTCAGT1356980.3738408593033735No Hit
ACCCTGTAGAACCGAATTTGCG1324160.36479912176683155No Hit
TGAGATGAAGCACTGTAGCTCT1301970.35868589337146695No Hit
TCCTTCATTCCACCGGAGTCT1229650.33876211340063467No Hit
TAGCTTATCAGACTGGTGTTGG1144370.31526792153237454No Hit
ATGACCTATGAATTGACAGCC1072340.2954240350376421No Hit
TGAGGTAGTAGTTTGTATAGTT1065850.2936360741414764No Hit
CATTGCACTTGTCTCGGTCTGA1063880.29309334949348775No Hit
TATTGCACTTGTCCCGGCCTGTT1055580.2908067431085609No Hit
AACTCCAGTCACTCGGCAATCT1037310.2857734541142702RNA PCR Primer, Index 48 (100% over 22bp)
AAGCTGCCAGCTGAAGAACTGC998520.27508701294905197No Hit
TCCAGTGATGACAGCCTATAATCTGACT995460.2742439990288259No Hit
CACCACGTTCCCGTGG994750.27404839775975387No Hit
TGAGGTAGTAGGTTGTATAGTTT990880.2729822330959386No Hit
TTCCCTTTGTCATCCTATGCCTG988400.27229900612791225No Hit
CTACGCCTGTCTGAGGGTCGCT954520.2629652441614881No Hit
TACCCTGTAGAACCGAATTTG924250.2546260182251345No Hit
TCCAGCATCAGTGATTTTGTT921240.253796779042167No Hit
CTGTCTGAGGGTCGCT906590.24976078102539861No Hit
TATTGCACTTGTCCCGGCCTGTAT874430.2409008700206701No Hit
TGAGAACTGAATTCCATAGATGG854840.23550392796275244No Hit
TGAGATGAAGCACTGTAGCTC836260.23038523559745844No Hit
AACTCCAGTCACTCGGCAATCTCGTATGC835010.23004086716599353RNA PCR Primer, Index 48 (100% over 29bp)
ATGACCTATGAATTGACAGCCA777210.21411727089505733No Hit
TGAGATGAAGCACTGTAGCT745540.20539235231546307No Hit
TTCAGTCATTGTTTCTGGTTGT743500.2048303430353124No Hit
TATTGCACTTGTCCCGGCCTGTTT711500.1960145111898114No Hit
AACATTCAACGCTGTCGGTGAGA697840.19225125297076315No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT690570.1902484061733634No Hit
TTCACAGTGGTTAAGTTCTGCC685440.1888351181306315No Hit
TATTGCACTTGTCCCGGCCTGTA661000.18210202655863011No Hit
TGAGGTAGTAGATTGAATAGTT651400.17945727700497982No Hit
TTCACGTAATCCAGGATAGGCT646080.17799164496066527No Hit
TTCAAGTAATCCAGGATGGGCT637580.17564993962670408No Hit
TTCACAGTGGTTAAGTTCTGC630630.17373525114775934No Hit
CATTATTACTTTTGGTACGCG624670.17209330246653476No Hit
TTCACAGTGGCTAAGTTCTGCT604550.166550348193676No Hit
TGTCTGAGGGTCGCT594920.16389733379767055No Hit
ACAGTAGTCTGCACATTGGTTA590770.16275403060520713No Hit
TTCACAGTGGTTAAGTTCTGCCT586780.16165480657197123No Hit
GGCCGTGATCGTCTAGTGGTTAGGACCC583700.16080628275684175No Hit
TGTAAACATCCTTGACTGGAAGCT582620.1605087484320561No Hit
ACCCTGTAGAACCGAATTTGC580190.15983929620128837No Hit
CATAAAGTAGAAAGCACTACT570020.1570375146428901No Hit
AACATTCAACGCTGTCGGTGG551800.15201800038585794No Hit
AACTCCAGTCACTCGGCAATCTCG536180.14771477246627276RNA PCR Primer, Index 48 (100% over 24bp)
AACATTCAACGCTGTCGGTGT532470.14669268696168497No Hit
TCCAGCATCAGTGATTTTGTTG526760.1451196119667534No Hit
AACATTCATTGCTGTCGGTGGGT513810.1415519550167772No Hit
TGAAATGTTTAGGACCACTTGT500550.13789889469579775No Hit
GGAATACCAGGTGCTGTAAGCTT478430.13180495093259517No Hit
TCCTCGGTAGTATAGTGGTGAGTATCTCC467860.12889297147612813No Hit
TTTGGTCCCCTTCAACCAGCTG466270.1284549348313048No Hit
TACAGTAGTCTGCACATTGGTT457460.12602782612634028No Hit
AACTCCAGTCACTCGGCAATCTC450120.1240056946967785RNA PCR Primer, Index 48 (100% over 23bp)
TTCAAGTAATCCAGGATAGGCA442910.12201937758408905No Hit
TCCCTGAGACCCTTAACCTGTG442740.12197254347740982No Hit
TCCCTGAGACCCTTAACCTGTGA435130.11987602846665162No Hit
GAATACCAGGTGCTGTAAGCTT429890.11843243600195084No Hit
AATGACACGTTTTCTCCCGGATT421650.11616235930173432No Hit
AACATTCATTGCTGTCGGTGGG412890.11374902533402842No Hit
GTGAAATGTTTAGGACCACTTG412210.11356168890731154No Hit
TATTGCACTTGTCCCGGCCTGTAA409500.11281509814789566No Hit
ACCACGTTCCCGTGG404790.11151751789813598No Hit
AACATTCAACGCTGTCGGTG404030.11130814189180534No Hit
TTCCCTTTGTCATCCTATGCC403890.11126957262748127No Hit
TGTAAACATCCTACACTCTCAGCT402720.11094724377563013No Hit
CCCTGAGACCCTTAACCTGTGA398510.10978741089845642No Hit
TACAGTACTGTGATAACTGAAG397780.10958629973448092No Hit
TCCCTGAGACCCTTAACCTGT394370.10864686265344471No Hit
TGAGGTAGTTGGTTGTATAGTT370340.1020267239269638No Hit
CTGGACAACTCTTAGCGG366430.10094953947334165No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC89500.0617.9167523
GATTCCT83650.0555.732723
CAACCCG9900.0531.095423
TATCTCC59600.0518.554823
GACGTTC10950.0509.4470223
TAACTAA2400.0507.617123
GCATTCG4050.0506.627623
ATTCGGC34450.0477.4105523
CGCACTG10700.0437.454623
AATAACC3150.0427.4670423
ACCCTAC7750.0409.54123
AAATAGC15650.0403.567123
CCCTACG1200.0400.7503423
GATATCT7600.0392.313523
CACACTC7700.0383.054923
ATAACTA32900.0341.3743622
TTCTCGC40900.0340.1968723
ATACATT2600.0332.9310623
TCTGACT324500.0325.540223
CACGCGA2300.0320.6002823