FastQCFastQC Report
Wed 7 Dec 2016
nfu_skin_mzm_39_JM18_5_ATCACG_L005_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_39_JM18_5_ATCACG_L005_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences12635926
Sequences flagged as poor quality0
Sequence length8-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCCCTTTGTCATCCTATGCCT133789610.588032883383459No Hit
TTCAAGTAATCCAGGATAGGCT9445957.47547112890658No Hit
AACATTCAACGCTGTCGGTGAG5872874.647755930194589No Hit
AACATTCAACGCTGTCGGTGAGT4097893.243046849118933No Hit
TACCCTGTAGAACCGAATTTGT3649302.888035273394289No Hit
TCCTTCATTCCACCGGAGTCTG3184242.519989433303107No Hit
TAGCTTATCAGACTGGTGTTGGC3141402.4860861008524426No Hit
TACCCTGTAGAACCGAATTTGC3136162.4819391946423237No Hit
TGAGGTAGTAGGTTGTATAGTT2325561.8404349629777823No Hit
TACCCTGTAGAACCGAATTTGCG2217261.7547269586732306No Hit
AAGCTGCCAGCTGAAGAACTGT2188791.7321959625277956No Hit
AACAGTAAGAGTTTATGTGCTG2090911.6547342869845865No Hit
TAACGGAACCCATAATGCAGCTG1934931.5312926017452144No Hit
TATTGCACTTGTCCCGGCCTGT1428101.13019022112032No Hit
TTCACAGTGGTTAAGTTCTG1411191.1168077432552233No Hit
TTCACAGTGGCTAAGTTCTG1247540.9872960636205056No Hit
TACCCTGTAGATCCGGATTTGT1139770.9020074983028549No Hit
CCACGTTCCCGTGG977310.7734375779028779No Hit
TCCTTCATTCCACCGGAGTCTGT910970.7209364790518715No Hit
AACATTCAACGCTGTCGGTGA838650.6637028421977147No Hit
ACCCTGTAGAACCGAATTTGCG768700.60834480986989No Hit
TTCACAGTGGCTAAGTTCTGC659790.5221540550332441No Hit
TTCAAGTAATCCAGGATAGGC627850.496876920615078No Hit
CCTGTCTGAGGGTCGCT622820.49289620721109No Hit
TTGGTCCCCTTCAACCAGCTGT603660.47773309213744997No Hit
AAGCTGCCAGCTGAAGAACT585020.46298150210756217No Hit
TTCAAGTAATCCAGGATAGGTT560910.4439009851751268No Hit
TGAGGTAGTAGGTTGTATAGT500720.3962669613608057No Hit
TCCTTCATTCCACCGGAGTCT494080.3910121031098156No Hit
TAGCTTATCAGACTGGTGTTGG487070.38546442896230954No Hit
TGAGAACTGAATTCCATAGATGG462240.3658141081231403No Hit
ACAGTAGTCTGCACATTGGTT459180.3633924415195214No Hit
TTCCAGTGATGACAGCCTATAATCTGACT445010.35217838407727303No Hit
TTTGGTCCCCTTCAACCAGCTGT400720.3171275298699913No Hit
CATTGCACTTGTCTCGGTCTGA397410.3145080146876454No Hit
TGAGGTAGTAGTTTGTATAGTT382610.30279537882700486No Hit
TACCCTGTAGAACCGAATTTG368070.2912885054882404No Hit
TTCACAGTGGCTAAGTTCAGT368050.29127267760194225No Hit
TGAGATGAAGCACTGTAGCTCT355790.28157018330116845No Hit
TATTGCACTTGTCCCGGCCTGTT352640.27907729120920777No Hit
TTCAAGTAATCCAGGATAGGCTT347200.2747721061361075No Hit
AAGCTGCCAGCTGAAGAACTGC345740.2736166704363416No Hit
ACCCTGTAGAACCGAATTTGC338500.2678869755964067No Hit
TGAGATGAAGCACTGTAGCTC327150.2589046501221992No Hit
CATTATTACTTTTGGTACGCG324190.25656212295007114No Hit
TGAGGTAGTAGGTTGTATAGTTT311430.24646393149184317No Hit
TTCAGTCATTGTTTCTGGTTGT308000.24374944899170822No Hit
TCCAGCATCAGTGATTTTGTT307820.24360699801502478No Hit
TGTAAACATCCTACACTCTCAGCT295830.23411818017927613No Hit
TGAGATGAAGCACTGTAGCT291360.2305806475916367No Hit
TATTGCACTTGTCCCGGCCTGTA285140.22565817495290807No Hit
ATGACCTATGAATTGACAGCC284440.22510419893247238No Hit
TCCAGTGATGACAGCCTATAATCTGACT277940.21996013588556945No Hit
TTCACAGTGGTTAAGTTCTGCC272990.21604273402677415No Hit
TGGACGGAGAACTGATAAGGGC268250.21229152497410952No Hit
AACTCCAGTCACATCACGATCTCGTATGC256800.2032300600684113Illumina PCR Primer Index 1 (100% over 29bp)
TTCCCTTTGTCATCCTATGCC249050.19709675412787317No Hit
TTCACAGTGGTTAAGTTCTGC245760.19449306683182538No Hit
GTGAAATGTTTAGGACCACTTG237830.1882173099146038No Hit
AACTCCAGTCACATCACGATCT232200.18376175992167096Illumina PCR Primer Index 1 (100% over 22bp)
TTCACAGTGGCTAAGTTCTGCT228350.1807148918092746No Hit
TACCCTGTAGATCCGGATTTGTG222900.17640179279302523No Hit
TATTGCACTTGTCCCGGCCTGTAT220600.17458158586873648No Hit
TTCACAGTGGTTAAGTTCTGCCT213130.16866987033637265No Hit
CACCACGTTCCCGTGG209650.16591581812049233No Hit
AACATTCATTGCTGTCGGTGGG206510.16343083997168076No Hit
TGTAAACATCCTTGACTGGAAGCT200350.1585558509918466No Hit
CTGGACAACTCTTAGCGG199460.15785151005157833No Hit
ACAGTAGTCTGCACATTGGTTA180720.14302078059019974No Hit
CTTCCCTTTGTCATCCTATGCCT180660.14297329693130523No Hit
AACATTCAACGCTGTCGGTGAGA179460.14202362375341546No Hit
TGAAATGTTTAGGACCACTTGT177570.14052788849823905No Hit
AATGACACGTTTTCTCCCGGATT177360.14036169569210835No Hit
TGTAAACATCCCCGACTGGA177220.14025090048802122No Hit
TTCAAGTAATCCAGGATGGGCT177030.1401005355681887No Hit
TTCCCTTTGTCATCCTATGCCTG176430.1396256989792438No Hit
TGAGGTAGTAGATTGAATAGTT174870.13839112384798707No Hit
TCAGTAACTGGAATCTGTCCCT174070.13775800839606056No Hit
ATGACCTATGAATTGACAGCCA171900.1360406827327099No Hit
TGAGGTAGTTGGTTGTATAGTT171600.13580326443823745No Hit
TTCAAGTAATCCAGGATAGGCA167720.13273265449639385No Hit
GAATACCAGGTGCTGTAAGCTT167640.1326693429512012No Hit
AACATTCATTGCTGTCGGTGGGT165010.1305879759029928No Hit
TACCCTGTAGAACCGAATGTGT162140.12831667421920642No Hit
CATAAAGTAGAAAGCACTACT162040.1282375347877156No Hit
TGAAATGTTTAGGACCACTTG161730.12799220255009408No Hit
ACCCTGTAGAACCGAATTTGT157860.12492950655139956No Hit
GGAATACCAGGTGCTGTAAGCTT157750.12484245317675967No Hit
TCCAGCATCAGTGATTTTGTTG157460.1246129488254363No Hit
TCCCTGAGACCCTTAACCTGTG153570.12153442494044363No Hit
ACTGGACAACTCTTAGCGG152670.12082217005702628No Hit
TTTGGTCCCCTTCAACCAGCTG149250.11811560150004044No Hit
AACATTCAACGCTGTCGGTGT147790.11696016580027456No Hit
TACAGTACTGTGATAACTGAAG145400.11506873338764409No Hit
TGTGGTCGGCGTCC144660.11448310159461206No Hit
AAGCTGCCAGCTGAAGAACTG144260.1141665438686488No Hit
TTCCCTTTGTCATCCTATGCCA144130.11406366260771075No Hit
AACATTCAACGCTGTCGGTGG143830.11382624431323829No Hit
TCCCTGAGACCCTTAACCTGTGA132970.10523170205333585No Hit
TATGTGCCCTTGGACTACATCG131750.10426620098914793No Hit
TATTGCACTTGTCCCGGCCTGTTT131260.10387841777484293No Hit
TGTAAACATCCCCGACTGGAAGCT128850.1019711574759143No Hit
CTGTCTGAGGGTCGCT127230.1006890986857631No Hit
ACCCTGTAGAACCGAATTTGTG126790.10034088518720352No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GATACCT50.0054405351226.559923
CAGTTAC50.0054405351226.559923
ACATAGC205.0931703E-111226.559923
CAATATA50.0054405351226.559923
CGTATGC30900.01198.773823
GATTCCT10050.01025.184423
AATAACC600.01022.133323
CATAGCT500.0981.247923
TAACTGC2350.0939.492723
TAACTAA650.0849.156823
AAATAGC7000.0814.786223
GTATGCC750.0735.935923
CAACCCG1000.0674.60823
TCGTATG31250.0673.889122
TCTGACT83450.0668.030523
ATAACTA8000.0663.515722
GCTTCCT750.0654.165323
GGATTCC12550.0586.0597522
GCTGAGC2200.0585.403623
ACAACCC1550.0581.957722