FastQCFastQC Report
Tue 6 Dec 2016
JM1_5_TCCCGA_L006_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM1_5_TCCCGA_L006_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences63144669
Sequences flagged as poor quality0
Sequence length8-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT44269817.010854708890786No Hit
TTCCCTTTGTCATCCTATGCCT41342136.547208284518841No Hit
AACATTCAACGCTGTCGGTGAG17171192.7193412004424315No Hit
TGAGGTAGTAGGTTGTATAGTT15779432.4989330453216883No Hit
AACATTCAACGCTGTCGGTGAGT15423142.442508646296016No Hit
TCCTTCATTCCACCGGAGTCTG15150522.399334772029607No Hit
TACCCTGTAGAACCGAATTTGT15032412.3806301051320737No Hit
TACCCTGTAGAACCGAATTTGC12198971.931908139387032No Hit
AAGCTGCCAGCTGAAGAACTGT11778781.865364121237218No Hit
AACAGTAAGAGTTTATGTGCTG10991431.7406742602451521No Hit
TAGCTTATCAGACTGGTGTTGGC9975981.5798610014093193No Hit
TACCCTGTAGAACCGAATTTGCG8235791.304273207925122No Hit
CCACGTTCCCGTGG7983181.2642682472529867No Hit
CCTGTCTGAGGGTCGCT7398961.1717473726879462No Hit
TATTGCACTTGTCCCGGCCTGT7102361.1247758698362962No Hit
TTGGTCCCCTTCAACCAGCTGT6274910.9937355123359661No Hit
TCCTTCATTCCACCGGAGTCTGT6246750.9892759117954995No Hit
TAACGGAACCCATAATGCAGCTG6211120.9836333135264356No Hit
TTCACAGTGGCTAAGTTCTG4929730.7807040686205831No Hit
AACATTCAACGCTGTCGGTGA4589330.7267961132237466No Hit
TTTGGTCCCCTTCAACCAGCTGT4401020.6969741182743392No Hit
TGAGGTAGTAGGTTGTATAGT3684890.5835631191605423No Hit
TTCACAGTGGTTAAGTTCTG3679320.5826810177752297No Hit
TTCACAGTGGCTAAGTTCTGC3373350.5342256208516984No Hit
TTCAAGTAATCCAGGATAGGC3173200.5025285665841402No Hit
ACAGTAGTCTGCACATTGGTT3168730.5018206683449398No Hit
ACCCTGTAGAACCGAATTTGCG3115000.49331163648985155No Hit
AAGCTGCCAGCTGAAGAACT2957790.4684148395805195No Hit
TTCAAGTAATCCAGGATAGGTT2781610.4405138302332379No Hit
TCCTTCATTCCACCGGAGTCT2570130.40702248356072623No Hit
TTCCAGTGATGACAGCCTATAATCTGACT2505960.39686010548253886No Hit
TACCCTGTAGATCCGGATTTGT2464780.3903385731580919No Hit
TGAGGTAGTAGTTTGTATAGTT2267040.35902318214701545No Hit
TTCAAGTAATCCAGGATAGGCTT2242340.355111529684319No Hit
TGAGGTAGTAGGTTGTATAGTTT2227480.35275820354684256No Hit
AACTCCAGTCACTCCCGAATCT2178660.3450267511893997RNA PCR Primer, Index 46 (100% over 22bp)
TGAGATGAAGCACTGTAGCTCT2098410.33231783984804797No Hit
TTCACAGTGGCTAAGTTCAGT2090150.3310097325872434No Hit
TACCCTGTAGAACCGAATTTG2018210.31961684683151953No Hit
CTACGCCTGTCTGAGGGTCGCT1946420.30824771605026546No Hit
TAGCTTATCAGACTGGTGTTGG1840920.29154005067316136No Hit
CTGTCTGAGGGTCGCT1823060.28871162504628856No Hit
TATTGCACTTGTCCCGGCCTGTT1737130.27510319200501315No Hit
TCCAGTGATGACAGCCTATAATCTGACT1698640.26900766555605826No Hit
CATTGCACTTGTCTCGGTCTGA1685240.26688555450342133No Hit
AAGCTGCCAGCTGAAGAACTGC1628720.25793468012319454No Hit
ATGACCTATGAATTGACAGCC1507690.2387675830559821No Hit
TATTGCACTTGTCCCGGCCTGTAT1425260.22571343275233574No Hit
TCCAGCATCAGTGATTTTGTT1364360.21606891311759033No Hit
AACTCCAGTCACTCCCGAATCTCG1353270.2143126286717886RNA PCR Primer, Index 46 (100% over 24bp)
ACCCTGTAGAACCGAATTTGC1320160.2090691139738178No Hit
TGAGATGAAGCACTGTAGCTC1301680.20614250111913643No Hit
TATTGCACTTGTCCCGGCCTGTA1290300.20434029038935972No Hit
TGTCTGAGGGTCGCT1277390.20229577891999087No Hit
TTCCCTTTGTCATCCTATGCCTG1203490.1905924948311947No Hit
TGAGAACTGAATTCCATAGATGG1171870.18558494621295743No Hit
TTCACAGTGGCTAAGTTCTGCT1131670.17921861305504666No Hit
AACTCCAGTCACTCCCGAATCTCGTATGC1111250.17598476919722233RNA PCR Primer, Index 46 (100% over 29bp)
ATGACCTATGAATTGACAGCCA1103880.17481760811827202No Hit
TTCACGTAATCCAGGATAGGCT1081510.17127494959234008No Hit
CATTATTACTTTTGGTACGCG1075020.17024715103027938No Hit
TGAGGTAGTAGATTGAATAGTT1039770.16466473202987256No Hit
CTGGACAACTCTTAGCGG1023820.16213878641124874No Hit
TATTGCACTTGTCCCGGCCTGTTT1008460.15970627702553955No Hit
TGAGATGAAGCACTGTAGCT1003060.15885109794462618No Hit
CACCACGTTCCCGTGG975280.1544516766728162No Hit
AACTCCAGTCACTCCCGAATCTC969130.15347772271955373RNA PCR Primer, Index 46 (100% over 23bp)
TTCCCTTTGTCATCCTATGCC963940.15265580060289807No Hit
TTCAGTCATTGTTTCTGGTTGT962140.15237074090926028No Hit
TTTGGTCCCCTTCAACCAGCTG951460.15067938672700937No Hit
TTCAAGTAATCCAGGATGGGCT940870.14900228552944034No Hit
TTCACAGTGGTTAAGTTCTGCC933760.14787629973957106No Hit
TGGACGGAGAACTGATAAGGGC931460.14751205679770055No Hit
TACCCTGTAGAACCGAATGTGT928340.14701795332872836No Hit
ACAGTAGTCTGCACATTGGTTA890160.14097152049367778No Hit
TTCACAGTGGTTAAGTTCTGC880290.13940844317356385No Hit
TGTAAACATCCTACACTCTCAGCT854230.13528141227567445No Hit
TTCAAGTAATCCAGGATAGGCA852560.13501694022657718No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT816960.12937909295240743No Hit
CCCTGAGACCCTTAACCTGTGA797910.12636221119474075No Hit
ACTGGACAACTCTTAGCGG796120.12607873516606763No Hit
TTAGGTAGTAGGTTGTATAGTT790370.12516812781139133No Hit
TGAGGTAGTTGGTTGTATAGTT786730.12459167376425713No Hit
AACATTCAACGCTGTCGGTGAGA780420.12359238117156017No Hit
TTCACAGTGGTTAAGTTCTGCCT761840.12064993166723227No Hit
TCCCTGAGACCCTTAACCTGTG760110.12037595762834706No Hit
TCCCTGAGACCCTTAACCTGTGA756990.11988185415937487No Hit
TATTGCACTTGTCCCGGCCTGTAA740710.11730364759691748No Hit
TCCTCGGTAGTATAGTGGTGAGTATCTCC720700.114134734002644No Hit
AACATTCAACGCTGTCGGTGT703670.11143775256783751No Hit
CAAGTTTTTGT702170.11120020282313935No Hit
ACCCTGTAGAACCGAATTTGT699180.11072668699870768No Hit
TACAGTACTGTGATAACTGAAG676670.10716185716327059No Hit
TCCAGCATCAGTGATTTTGTTG675200.1069290584134664No Hit
TCCCTGAGACCCTTAACCTGT673720.10669467599869753No Hit
TGAAATGTTTAGGACCACTTGT665620.10541190737732745No Hit
AACATTCATTGCTGTCGGTGGG656820.10401828220843157No Hit
AACATTCATTGCTGTCGGTGGGT656140.10391059299083506No Hit
TTCCCTTTGTCATCCTATGCCA650150.10296197767700706No Hit
TGTAAACATCCTTGACTGGAAGCT646570.10239502561966078No Hit
CTTCCCTTTGTCATCCTATGCCT636670.10082719730465291No Hit
ACCCTGTAGAACCGAATTTGTG634890.10054530494094441No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC125550.0733.0705623
GATTCCT100500.0667.5321723
CAACCCG21600.0661.586123
TATCTCC98800.0615.299123
TAACTAA3550.0565.735523
GACGTTC11300.0560.5364423
AAATAGC19800.0544.2237523
AATAACC4900.0488.6906723
ACCCTAC9650.0472.2730423
ATTCGGC33850.0456.3938623
GCATTCG3650.0455.0027523
ATAACTA45750.0405.1777622
ATACATT2950.0392.769423
TCTGACT531950.0387.7842723
TCGTATG133100.0385.0785522
ACAACCC43100.0371.7727722
GGATTCC128800.0355.9781522
GATATCT7350.0352.0674723
CACACTC7100.0342.7051423
TGACGTT10700.0338.6536322