FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_39_JM24_5_CGATGT_L005_R1_001_TRIMMED_prinseq_good_oABh.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_39_JM24_5_CGATGT_L005_R1_001_TRIMMED_prinseq_good_oABh.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11647208
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT9809648.422310308187164No Hit
TTCCCTTTGTCATCCTATGCCT7317586.282690237866448No Hit
AACATTCAACGCTGTCGGTGAG4352993.7373677880570173No Hit
TAGCTTATCAGACTGGTGTTGGC4102893.522638215098417No Hit
AACATTCAACGCTGTCGGTGAGT3841743.298421389915935No Hit
TCCTTCATTCCACCGGAGTCTG2883872.4760182869576983No Hit
TACCCTGTAGAACCGAATTTGT2605392.2369223594186693No Hit
TAACGGAACCCATAATGCAGCTG2442942.097446873104696No Hit
AAGCTGCCAGCTGAAGAACTGT2412242.0710886248446836No Hit
TACCCTGTAGAACCGAATTTGC2338642.0078975150096054No Hit
CCACGTTCCCGTGG2046291.7568931541361674No Hit
TACCCTGTAGAACCGAATTTGCG1787741.5349086235945988No Hit
TGAGGTAGTAGGTTGTATAGTT1761021.5119675032849076No Hit
AACAGTAAGAGTTTATGTGCTG1686931.4483556917675036No Hit
TTGGTCCCCTTCAACCAGCTGT1348481.1577710297609523No Hit
TATTGCACTTGTCCCGGCCTGT1335391.1465322848188166No Hit
CCTGTCTGAGGGTCGCT1313571.1277981813323845No Hit
TTTGGTCCCCTTCAACCAGCTGT1224091.050972902690499No Hit
TCCTTCATTCCACCGGAGTCTGT1007300.8648424583814422No Hit
AACATTCAACGCTGTCGGTGA905090.7770875217477012No Hit
TTCACAGTGGCTAAGTTCTG788950.6773726372878376No Hit
TTCACAGTGGTTAAGTTCTG725360.6227758618202749No Hit
ACCCTGTAGAACCGAATTTGCG708650.6084290758780988No Hit
TTCAAGTAATCCAGGATAGGC681310.5849556391540359No Hit
TACCCTGTAGATCCGGATTTGT639130.5487409514795306No Hit
TTCAAGTAATCCAGGATAGGTT617700.5303416921892354No Hit
AAGCTGCCAGCTGAAGAACT606590.5208029254736414No Hit
TTCACAGTGGCTAAGTTCTGC528840.4540487299617213No Hit
ACAGTAGTCTGCACATTGGTT508010.4361646155885599No Hit
AAGCTGCCAGCTGAAGAACTGC458630.3937681889084491No Hit
TCCTTCATTCCACCGGAGTCT448680.38522536903264715No Hit
TTCCAGTGATGACAGCCTATAATCTGACT430870.3699341507423925No Hit
TTCAAGTAATCCAGGATAGGCTT408540.3507621740763967No Hit
TTCAAGTAATCCAGGATGGGCT404010.3468728299520366No Hit
TAGCTTATCAGACTGGTGTTGG401700.3448895220210715No Hit
TTTGGTCCCCTTCAACCAGCTG381390.32745186657609276No Hit
TGAGATGAAGCACTGTAGCTCT374290.32135598505667623No Hit
TGAGGTAGTAGGTTGTATAGT358910.30815110368081344No Hit
ATGACCTATGAATTGACAGCC349820.30034665818623657No Hit
CATTGCACTTGTCTCGGTCTGA348670.2993592970950635No Hit
TGAGATGAAGCACTGTAGCTC330230.28352717664181837No Hit
TTCACAGTGGCTAAGTTCAGT327490.2811746815202407No Hit
TTCACAGTGGTTAAGTTCTGCC327170.28089993756443604No Hit
TACCCTGTAGAACCGAATTTG323360.2776287673406365No Hit
TATTGCACTTGTCCCGGCCTGTT315850.27118087012784525No Hit
CACCACGTTCCCGTGG300340.2578643740199368No Hit
TCCAGTGATGACAGCCTATAATCTGACT294910.253202312519876No Hit
CTGTCTGAGGGTCGCT276280.23720706284287188No Hit
GAATACCAGGTGCTGTAAGCTT273110.2344853805306817No Hit
CTACGCCTGTCTGAGGGTCGCT271220.23286267404171024No Hit
CTGGACAACTCTTAGCGG258910.22229361749184867No Hit
TTCACAGTGGTTAAGTTCTGCCT258270.2217441295802393No Hit
TTCCCTTTGTCATCCTATGCCTG250930.2154421900939693No Hit
ATGACCTATGAATTGACAGCCA249900.21455785798622298No Hit
TTCACAGTGGCTAAGTTCTGCT244570.20998165397235116No Hit
ACCCTGTAGAACCGAATTTGC243030.20865944868504108No Hit
TCCAGCATCAGTGATTTTGTT237220.20367112873746224No Hit
TGAGGTAGTAGGTTGTATAGTTT232100.19927522544458723No Hit
TGAGAACTGAATTCCATAGATGG225150.1933081301544542No Hit
TGTAAACATCCTACACTCTCAGCT220890.18965060124280428No Hit
TGAGGTAGTAGTTTGTATAGTT218970.18800213750797617No Hit
AACATTCATTGCTGTCGGTGGGT212030.182043627966462No Hit
TGAGATGAAGCACTGTAGCT202620.1739644385160804No Hit
TATTGCACTTGTCCCGGCCTGTAT200320.17198971633373422No Hit
TATGTGCCCTTGGACTACATCG198760.17065033954918638No Hit
AACATTCATTGCTGTCGGTGGG197000.16913924779226058No Hit
TTTGGTCCCCTTCAACCAGCT196940.16908773330054722No Hit
TGTAAACATCCTTGACTGGAAGCT196110.1683751161651788No Hit
ACTGGACAACTCTTAGCGG195200.16759381304085924No Hit
TCCCTGAGACCCTTAACCTGTG192930.16564484810436972No Hit
AACATTCAACGCTGTCGGTGAGA192630.16538727564580283No Hit
CCTTTCTGAGGGTCGCT188680.16199590494133873No Hit
TATTGCACTTGTCCCGGCCTGTA188140.16153227451591834No Hit
TGGACGGAGAACTGATAAGGGC187340.1608454146264066No Hit
TGTCTGAGGGTCGCT187280.16079390013469322No Hit
TTCAAGTAATCCAGGATAGGCA184350.15827827578935658No Hit
TTCACAGTGGTTAAGTTCTGC181430.15577123719263877No Hit
CATTATTACTTTTGGTACGCG180250.154758118855609No Hit
TTGTTCCCCTTCAACCAGCTGT179910.1544662034025665No Hit
TCCCTGAGACCCTTAACCTGTGA177060.15201926504618105No Hit
ACAGTAGTCTGCACATTGGTTA169180.1452536951344906No Hit
TATTGCACTTGTCCCGGCCTGTTT166740.14315877247147987No Hit
GGAATACCAGGTGCTGTAAGCTT166310.1427895852808673No Hit
TACCCTGTAGAACCGAATGTGT165940.14247191258196815No Hit
TACCCTGTAGATCCGGATTTGTG165000.14166485221179187No Hit
TCCAGCATCAGTGATTTTGTTG164190.14096940657366125No Hit
AATGACACGTTTTCTCCCGGATT160460.13776692233881288No Hit
TTCAGTCATTGTTTCTGGTTGT156520.13438413738296764No Hit
CCCTGAGACCCTTAACCTGTGA152020.13052055050446423No Hit
CTTCCCTTTGTCATCCTATGCCT151930.13044327876689416No Hit
TGTAAACATCCCCGACTGGAAGCT151330.12992813384976037No Hit
TGTAAACATCCCCGACTGGA149260.12815088388564883No Hit
ACCACGTTCCCGTGG146740.1259872752336869No Hit
ACCCTGTAGAACCGAATTTGTG145740.12512870037179727No Hit
TTCCCTTTGTCATCCTATGCC141600.12157420044357412No Hit
CATAAAGTAGAAAGCACTACT137950.11844040219767689No Hit
AACATTCAACGCTGTCGGTGG134060.11510054598492618No Hit
TTTTGTCCCCTTCAACCAGCTGT129690.11134857383846841No Hit
TTCCCTTTGTCATCCTATGCCA128030.1099233395677316No Hit
TCCCTGAGACCCTTAACCTGT127050.10908193620307975No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT125500.10775114516715079No Hit
TCCCTGAGACCCTAACTTGTGA124050.10650621161741079No Hit
CCCAGTGTTCAGACTACCTGT123420.10596530945442033No Hit
AAGCTGCCAGCTGAAGAACTG122210.10492643387153384No Hit
AATACCAGGTGCTGTAAGCTT122030.10477189039639372No Hit
AACATTCAACGCTGTCGGTGT121860.10462593266987247No Hit
CCCAGTGTTCAGACTACCTGTT119610.10269413923062076No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCAATC50.00608570131159.701523
GATTCCT14950.0961.892823
GCCCCCC209.616997E-8869.776123
TAACTGC2100.0855.970223
TAACTAA700.0828.358223
CAACCCG1400.0786.940323
AAATAGC2750.0780.162823
AATAACC950.0732.4430523
TCTGACT86150.0592.9756523
ATAACTA11200.0538.43622
GGATTCC17300.0479.7011422
ACAACCC4050.0478.1218622
CGCGTAC201.8528608E-6414.9414722
ATCACTA550.0402.3674622
GCTGAGC3350.0398.1064523
GCGCGCC5250.0386.5671423
TCGGATA303.763469E-4386.5671423
GCTTCCT1650.0386.5671423
AAAATAG2800.0365.5436722
ATAAAAA700.0355.6641222