FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_5_JM100_5_ATGAGC_L001_R1_001_TRIMMED_prinseq_good_iuXP.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_5_JM100_5_ATGAGC_L001_R1_001_TRIMMED_prinseq_good_iuXP.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8038166
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG5127966.379514929151749No Hit
AACATTCAACGCTGTCGGTGAGT5049246.281582141996073No Hit
TAGCTTATCAGACTGGTGTTGGC2568853.1958160605292303No Hit
TTCAAGTAATCCAGGATAGGCT2428553.0212737582179816No Hit
TACCCTGTAGAACCGAATTTGT1764622.1953017641088772No Hit
TCCTTCATTCCACCGGAGTCTG1668222.0753739099192527No Hit
CCTGTCTGAGGGTCGCT1263861.572323836059121No Hit
AAGCTGCCAGCTGAAGAACTGT1147701.4278132598903779No Hit
TATTGCACTTGTCCCGGCCTGT969751.2064319149417915No Hit
AACATTCAACGCTGTCGGTGA801540.997167761899916No Hit
TACCCTGTAGAACCGAATTTGCG674720.839395454137175No Hit
AACAGTAAGAGTTTATGTGCTG612820.7623878382208081No Hit
TGAGGTAGTAGGTTGTATAGTT605900.7537789092686068No Hit
CCTTTCTGAGGGTCGCT585860.7288478491237926No Hit
TAACGGAACCCATAATGCAGCTG534370.6647909485820521No Hit
ACAGTAGTCTGCACATTGGTT534300.6647038640406282No Hit
CTGTCTGAGGGTCGCT515980.6419125954850895No Hit
CTACGCCTGTCTGAGGGTCGCT499790.6217711851185955No Hit
TACCCTGTAGAACCGAATTTGC467510.5816127708733559No Hit
GCATCGATGGTTCAGTGGTAGAATGCTC453140.5637355585838859No Hit
TCCTTCATTCCACCGGAGTCTGT447840.5571420147332115No Hit
TTGGTCCCCTTCAACCAGCTGT428390.532944952866114No Hit
TTCACAGTGGTTAAGTTCTG413070.5138858789430325No Hit
TTTGGTCCCCTTCAACCAGCTGT403450.5019179748216198No Hit
ATGACCTATGAATTGACAGCC371090.46166003538618133No Hit
TTCACGTAATCCAGGATAGGCT355980.4428622150873719No Hit
TTCCCTTTGTCATCCTATGCCT347250.4320015287069215No Hit
TTCACAGTGGCTAAGTTCTG343830.42774682682592025No Hit
ACCCTGTAGAACCGAATTTGCG332670.4138630627931794No Hit
AACATTCATTGCTGTCGGTGGGT326470.40614986055276786No Hit
TGTCTGAGGGTCGCT323100.40195736191564096No Hit
TTCACAGTGGCTAAGTTCTGC316080.3932240264756911No Hit
AACATTCATTGCTGTCGGTGGG312920.3892927814628362No Hit
TTCAAGTAATCCAGGATAGGTT284420.3538369324544927No Hit
CCACGTTCCCGTGG272330.3387961880856902No Hit
TACAGTAGTCTGCACATTGGTT267820.33318545548822953No Hit
ATGACCTATGAATTGACAGCCA263430.32772401067606716No Hit
AAGCTGCCAGCTGAAGAACTGC241210.30008088909833414No Hit
CACCACGTTCCCGTGG241020.29984451677161184No Hit
ACATTAGTCTGCACATTGGTT236670.2944328345545489No Hit
AAGCTGCCAGCTGAAGAACT235780.2933256168135866No Hit
CCTGTCTGAGGGTCGCTT233930.291024096790238No Hit
TATGTGCCCTTGGACTACATCG217820.27098221161394276No Hit
TTAGGTAGTAGGTTGTATAGTT217190.27019845074112675No Hit
TTCACAGTGGTTAAGTTCTGCC204290.25415001382156077No Hit
TTCACAGTGGCTAAGTTCAGT199710.24845219668267615No Hit
ACAGTAGTCTGCACATTGGTTA194630.24213234710504858No Hit
TGAGGTAGTAGTTTGTATAGTT192330.2392709978868314No Hit
TTGTTCCCCTTCAACCAGCTGT189890.2362354795857662No Hit
TACCATGTAGAACCGAATTTGT186430.23193101510966557No Hit
TGATGTAGTAGGTTGTATAGTT185080.2302515275250598No Hit
GCATCGATGGTTCAGTGGTAGAATGC176340.21937840049583449No Hit
TTCAGTCATTGTTTCTGGTTGT173180.21544715548297957No Hit
TAGCTTATCAGACTGGTGTTGG166840.20755978415972No Hit
TTTCTGAGGGTCGCT161490.20090403706517135No Hit
ACCCTGTAGAACCGAATTTGTG161360.20074230863109818No Hit
CATTGCACTTGTCTCGGTCTGA161240.2005930208457999No Hit
TGTAAACATCCTTGACTGGAAGCT152230.18938399629965344No Hit
AACATTCATTGCTGTCGGTGGGTT151700.188724641914586No Hit
AACATTCAACGCTGTCGGTGAGTT150170.1868212226520328No Hit
TTTTGTCCCCTTCAACCAGCTGT148850.18517905701375165No Hit
TACCCTGTAGATCCGGATTTGT146250.18194448833228874No Hit
ACCACGTTCCCGTGG144320.17954344311874126No Hit
TTCACAGTGGTTAAGTTCTGC143080.17800080267065893No Hit
TTCAAGTAATCCAGGATAGGC134740.16762530159242792No Hit
TCCTTCATTCCACCGGAGTCT133510.16609510179312045No Hit
AACACTCAACGCTGTCGGTGAG131530.1636318533356987No Hit
AACACTCAACGCTGTCGGTGAGT129190.16072074152238208No Hit
TCCCTGAGACCCTTAACCTGTGA128900.16035996270791125No Hit
TTATGTAGTAGGTTGTATAGTT125020.1555329909832666No Hit
TACCCTGTAGAACCGAATGTGT121980.15175103375570995No Hit
TACCCTGTAGAACCGAATTTGTG117860.14662548646046872No Hit
TGAGATGAAGCACTGTAGCTC112750.14026831493651662No Hit
AACCCGTAGATCCGAACTTGTG109070.1356901561873691No Hit
CCTTTCTGAGGGTCGCTT109010.13561551229471996No Hit
CCCAGTGTTCAGACTACCTGTTC106980.13309006059342393No Hit
AGCTACATCTGGCTACTGGGTCTC106360.13231874036938276No Hit
CATTATTACTTTTGGTACGCG106140.1320450460963359No Hit
CTACGCCTGTCTGAGGGTCGCTT105510.1312612852235199No Hit
ACCACAGGGTAGAACCACGGAC101880.12674532971824667No Hit
TCCCTGAGACCCTTAACCTGTG101330.1260610940356295No Hit
TACCCTGTAGATCCGGATTTGTG100490.1250160795385415No Hit
TTCAAGTAATCCAGGATGGGCT100290.12476726656304436No Hit
TGGACGGAGAACTGATAAGGGC99370.1236227268757575No Hit
TATTGCACTTGTCCCGGCCTGTT97570.12138341009628316No Hit
AACATTCAACGCTGTCGGTGG97000.1206742931161163No Hit
GAAGGATCATTA93990.11692965783488424No Hit
AAGTTCTGTGATACACTCAGACT93070.11578511814759734No Hit
TGAGGTAGTAGTTTGTGCTGTT90640.11276204049530701No Hit
TACGCCTGTCTGAGGGTCGCT89660.111542856915371No Hit
CTGTCTGAGGGTCGCTT86270.10732547698069435No Hit
TAGCAGCACGTAAATATTGGAG84930.10565843004486347No Hit
TGTAAACATCCTACACTCTCAGCT84900.1056211080985389No Hit
ACATTAGTCTGCACATTGGTTA84880.10559622680098918No Hit
TCACAGTGAACCGGTCTCTTT84790.10548426096201545No Hit
AACAATCAACGCTGTCGGTGAG84280.10484978787449774No Hit
AAGTTCTGTGATACACTTTGACT83870.10433972127472858No Hit
TACCCTGTAGAACCGAATTTG83550.10394162051393316No Hit
TCCAGCATCAGTGATTTTGTTG83460.10382965467495943No Hit
AACAATCAACGCTGTCGGTGAGT81500.10139128751508739No Hit
CACGTTCCCGTGG81500.10139128751508739No Hit
TCCCTGTTCGGGCGCCA81430.1013042029736634No Hit
TTTGGTCCCCTTCAACCAGCTG80930.10068217053492053No Hit
TATTTGCCCTTGGACTACATCG80670.10035871366677425No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GATTCCT4750.01213.803123
CAACCCG6750.0981.1271423
TAACTGC1000.0857.043423
TAACTAA750.0831.072323
CGAGGTC352.7595706E-7667.8260523
AATGCTC66300.0539.3431422
ACAACCC9500.0502.2623322
ATAACTA3500.0491.4161422
TCTGACT21750.0476.4337223
CACGTCT2150.0398.6248223
GAATGCT70850.0396.276421
CATAGCT1200.0389.5651623
GACAACC16200.0370.662521
GACCACA1301.8189894E-12359.5986323
GACCCCA1152.3101165E-10338.7523223
AAATAGC953.619607E-8328.054923
ATGCTCG1451.8189894E-12322.3987723
GGATTCC8250.0319.444522
AACACAC800.0312.0888722
AGAATGC96450.0297.1320520