FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_5_JM102_5_ATTCCT_L002_R1_001_TRIMMED_prinseq_good_4YgE.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_5_JM102_5_ATTCCT_L002_R1_001_TRIMMED_prinseq_good_4YgE.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11543345
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG7035076.094481279040001No Hit
AACATTCAACGCTGTCGGTGAGT5924445.1323424882475575No Hit
TAGCTTATCAGACTGGTGTTGGC5056334.380298778213768No Hit
TACCCTGTAGAACCGAATTTGT3068302.658068350205248No Hit
TTCAAGTAATCCAGGATAGGCT3013532.610621098130568No Hit
CCTGTCTGAGGGTCGCT2246941.9465241660887724No Hit
AAGCTGCCAGCTGAAGAACTGT2071081.794176644638101No Hit
TCCTTCATTCCACCGGAGTCTG2053061.778565918284518No Hit
TATTGCACTTGTCCCGGCCTGT1489921.2907177252347566No Hit
AACAGTAAGAGTTTATGTGCTG1416201.226854087788245No Hit
TGAGGTAGTAGGTTGTATAGTT1384501.1993923771662374No Hit
TACCCTGTAGAACCGAATTTGCG1128640.9777408541458303No Hit
CTACGCCTGTCTGAGGGTCGCT1043670.904131341478575No Hit
GCATCGATGGTTCAGTGGTAGAATGCTC1027350.889993325158349No Hit
CCTTTCTGAGGGTCGCT998520.8650178955926553No Hit
AACATTCAACGCTGTCGGTGA885820.7673858833812903No Hit
ACAGTAGTCTGCACATTGGTT835310.7236290693901983No Hit
TTCCCTTTGTCATCCTATGCCT827750.7170798412418584No Hit
TTGGTCCCCTTCAACCAGCTGT824600.71435099618005No Hit
GCATCGATGGTTCAGTGGTAGAATGC817800.7084601560466225No Hit
TACCCTGTAGAACCGAATTTGC777890.6738861222635206No Hit
CTGTCTGAGGGTCGCT759130.6576343338954177No Hit
TTTGGTCCCCTTCAACCAGCTGT695690.6026762606506173No Hit
TGTCTGAGGGTCGCT534460.46300270848701136No Hit
TTCACAGTGGTTAAGTTCTG530380.45946820440695485No Hit
TTCACAGTGGCTAAGTTCTGC519640.45016414219621786No Hit
TAACGGAACCCATAATGCAGCTG516790.447695187140296No Hit
TACAGTAGTCTGCACATTGGTT493740.4277269716880159No Hit
TTCACAGTGGCTAAGTTCTG492520.4266700856640775No Hit
TATGTGCCCTTGGACTACATCG479850.4156940644154706No Hit
ACCCTGTAGAACCGAATTTGCG470550.40763747423298885No Hit
TTCACGTAATCCAGGATAGGCT458280.3970079729922306No Hit
TGAGGTAGTAGTTTGTATAGTT456200.3952060689514174No Hit
TCCTTCATTCCACCGGAGTCTGT448120.3882063647928742No Hit
CCACGTTCCCGTGG409480.35473253203469185No Hit
AACATTCATTGCTGTCGGTGGGT394200.3414954677348724No Hit
AACATTCATTGCTGTCGGTGGG392900.34036927770936415No Hit
TTAGGTAGTAGGTTGTATAGTT386410.33474699058201934No Hit
TAGCTTATCAGACTGGTGTTGG378790.32814578443250203No Hit
AAGCTGCCAGCTGAAGAACTGC375110.32495780036029415No Hit
TTCAAGTAATCCAGGATAGGTT368280.319040971226278No Hit
CCTGTCTGAGGGTCGCTT365860.3169445251787935No Hit
TTATGTAGTAGGTTGTATAGTT355410.3078916899737468No Hit
ACAGTAGTCTGCACATTGGTTA349220.30252929285228847No Hit
ACAACACTGAGACACGAGACGAACAC330860.28662402449203417No Hit
ACATTAGTCTGCACATTGGTT330320.28615622248143846No Hit
TGATGTAGTAGGTTGTATAGTT327550.2837565714270864No Hit
ACCCTGTAGAACCGAATTTGTG324390.28101906336508176No Hit
TTGTTCCCCTTCAACCAGCTGT318750.2761331312544154No Hit
TTCAGTCATTGTTTCTGGTTGT308880.2675827500607493No Hit
AAGCTGCCAGCTGAAGAACT307560.26643923403484865No Hit
TTCACAGTGGTTAAGTTCTGCC300050.2599333208874897No Hit
TACCATGTAGAACCGAATTTGT291680.25268238972325613No Hit
CACCACGTTCCCGTGG288210.24967632865516887No Hit
TTCACAGTGGCTAAGTTCAGT273680.23708898937006562No Hit
TGTAAACATCCTTGACTGGAAGCT271620.23530441132964494No Hit
TACCCTGTAGATCCGGATTTGT268830.23288743427490038No Hit
CATTGCACTTGTCTCGGTCTGA265730.23020190421407313No Hit
TTTTGTCCCCTTCAACCAGCTGT260470.22564516611086302No Hit
TTTCTGAGGGTCGCT252190.21847220194839537No Hit
CCCAGTGTTCAGACTACCTGTTC237620.20585021066250728No Hit
AACCCGTAGATCCGAACTTGTG232630.20152737356459502No Hit
CATTATTACTTTTGGTACGCG224890.1948222114127231No Hit
AAGTTCTGTGATACACTCAGACT224170.19419847539859547No Hit
TTCACAGTGGTTAAGTTCTGC221230.1916515533409077No Hit
AACATTCAACGCTGTCGGTGAGTT212990.1845132411792249No Hit
TACCCTGTAGAACCGAATTTGTG202460.17539110197260846No Hit
TGAGATGAAGCACTGTAGCTC195270.16916240483152847No Hit
TATTTGCCCTTGGACTACATCG194530.16852134281700842No Hit
GCATCGATGGTTCAGTGGTAGAATGCT194350.1683654088134765No Hit
AACATTCATTGCTGTCGGTGGGTT194020.16807952980700133No Hit
TGAGGTAGTAGTTTGTGCTGTT193560.1676810317979754No Hit
TACCCTGTAGATCCGGATTTGTG192610.16685804677933477No Hit
TCCAGCATCAGTGATTTTGTTG189410.16408588671654534No Hit
CTACGCCTGTCTGAGGGTCGCTT189030.16375669270908907No Hit
ACCACGTTCCCGTGG184490.1598236906200066No Hit
AAGTTCTGTGATACACTTTGACT183090.1586108705925362No Hit
TCCTTCATTCCACCGGAGTCT182800.15835964358684593No Hit
TCCCTGAGACCCTTAACCTGTGA178710.1548164765065932No Hit
AACACTCAACGCTGTCGGTGAG175790.15228688044929783No Hit
TACGCCTGTCTGAGGGTCGCT167690.14526985029036213No Hit
CCTTTCTGAGGGTCGCTT166220.1439963892615182No Hit
ACCACAGGGTAGAACCACGGAC159380.1380708971273058No Hit
TTCAAGTAATCCAGGATGGGCT157860.13675412109748084No Hit
TCCCTGAGACCCTTAACCTGTG157510.13645091609061324No Hit
TGTAAACATCCTACACTCTCAGCT157390.13634696008825864No Hit
TGGACGGAGAACTGATAAGGGC153790.13322828001762055No Hit
TTTGGTCCCCTTCAACCAGCTG152920.13247459900054967No Hit
TTCAAGTAATCCAGGATAGGC149790.12976307993913375No Hit
TGAGGTAGTAGATTGAATAGTT145700.12621991285888104No Hit
TACCCTGTAGAACCGAATGTGT144000.12474720282552414No Hit
CACGTTCCCGTGG140730.1219144017613612No Hit
AACACTCAACGCTGTCGGTGAGT139880.12117804674468276No Hit
TAGCAGCACGTAAATATTGGAG139520.12086617873761894No Hit
TAGCCTATCAGACTGGTGTTGGC139290.12066692973310596No Hit
ACATTAGTCTGCACATTGGTTA138880.12031174672506106No Hit
TATTGCACTTGTCCCGGCCTGTT138850.12028575772447242No Hit
AGCTACATCTGGCTACTGGGTCTC133930.11602356162793367No Hit
TGTAAACATCCCCGACTGGAAGCT131630.11403107158280378No Hit
TTAGGTAGTAGTTTGTATAGTT128500.11131955252138787No Hit
GAAGGATCATTA127310.11028865549803804No Hit
ACCCTGTAGAACCGAATTTGTGT126270.10938770347763149No Hit
TCCCTGAGACCCTAACTTGTGA125960.10911915047154876No Hit
CTGTCTGAGGGTCGCTT123860.10729992043034321No Hit
CCCAGTGTTCAGACTACCTGTT122720.10631233840797447No Hit
ACAACACTGAGACACGAGACGAACGC120590.10446711936618026No Hit
AAACCGTTACCATTACTGAGTTT120040.10399065435538833No Hit
TTTAAACATCCTTGACTGGAAGCT118980.10307237633458934No Hit
TTATGTAGTAGTTTGTATAGTT117230.10155635130025137No Hit
AACATTCAACGCTGTCGGTGG116280.10073336628161075No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GATTCCT13600.01217.938123
TAACTGC3000.01210.152223
ACGCGCT1450.01043.234723
GTGTGCT2700.01036.472923
GAGCGCA1650.01008.4601423
ACGCACT2700.0952.434623
GAGTCCC1700.0934.308723
ACACACT5450.0860.429323
AATAACC800.0850.888323
AGCGCCT1950.0775.7386523
TAACTAA451.0077201E-9672.306823
CGAGTCC2350.0643.69823
CAACCCG4850.0545.8160423
ATGCTCG3000.0529.441623
TCTGACT28500.0480.3455223
AATGCTC132900.0475.8364322
CACGTGT3200.0472.7157323
GACCCCA2250.0470.6147523
GACCACA1900.0437.88423
ACAACCC7650.0437.448622