FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_5_JM103_5_CAAAAG_L003_R1_001_TRIMMED_prinseq_good_AFHW.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_5_JM103_5_CAAAAG_L003_R1_001_TRIMMED_prinseq_good_AFHW.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11873861
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGT7447406.272096329913245No Hit
AACATTCAACGCTGTCGGTGAG7272756.125008537661001No Hit
TTCAAGTAATCCAGGATAGGCT4033273.3967636980085922No Hit
TACCCTGTAGAACCGAATTTGT3628413.0557962570051984No Hit
TAGCTTATCAGACTGGTGTTGGC3404932.8675845203173593No Hit
CCTGTCTGAGGGTCGCT3264922.7496700525633573No Hit
TCCTTCATTCCACCGGAGTCTG2069711.7430808731885947No Hit
AAGCTGCCAGCTGAAGAACTGT2037911.7162993570499097No Hit
TGAGGTAGTAGGTTGTATAGTT1973621.6621552164034932No Hit
TATTGCACTTGTCCCGGCCTGT1752441.4758805076124775No Hit
AACAGTAAGAGTTTATGTGCTG1468221.2365143907276663No Hit
TACCCTGTAGAACCGAATTTGCG1364891.1494913069977828No Hit
ACAGTAGTCTGCACATTGGTT1254651.056648717717009No Hit
TTTGGTCCCCTTCAACCAGCTGT1173640.9884232264467304No Hit
TAACGGAACCCATAATGCAGCTG1115200.9392058741465812No Hit
TTGGTCCCCTTCAACCAGCTGT1112620.937033034157971No Hit
AACATTCAACGCTGTCGGTGA1093960.9213178426124409No Hit
CTACGCCTGTCTGAGGGTCGCT1064720.8966923227415244No Hit
TACCCTGTAGAACCGAATTTGC1021000.8598719489810434No Hit
CTGTCTGAGGGTCGCT910790.7670546252815322No Hit
TGTCTGAGGGTCGCT808670.681050586662586No Hit
TGAGGTAGTAGTTTGTATAGTT646530.5444985417969774No Hit
ACCCTGTAGAACCGAATTTGCG628900.5296508018748072No Hit
TTCACAGTGGTTAAGTTCTG590530.4973361234395451No Hit
TCCTTCATTCCACCGGAGTCTGT585800.49335258346042626No Hit
TTCACAGTGGCTAAGTTCTG572050.48177252538159243No Hit
TTCCCTTTGTCATCCTATGCCT566190.4768373151749039No Hit
TTCACAGTGGCTAAGTTCTGC507280.42722413543496934No Hit
AACATTCATTGCTGTCGGTGGGT499010.420259256866827No Hit
CCTTTCTGAGGGTCGCT492250.4145660792222513No Hit
CCACGTTCCCGTGG488420.4113405066810198No Hit
TACAGTAGTCTGCACATTGGTT480080.4043166750899307No Hit
TATGTGCCCTTGGACTACATCG469740.39560847141464767No Hit
AACATTCATTGCTGTCGGTGGG464110.39086696399764154No Hit
ACAGTAGTCTGCACATTGGTTA452290.38091232498005495No Hit
TGTAAACATCCTTGACTGGAAGCT448480.3777035961596653No Hit
AAGCTGCCAGCTGAAGAACTGC436860.36791739435049814No Hit
GCATCGATGGTTCAGTGGTAGAATGCTC422320.35567200929840764No Hit
TTCAAGTAATCCAGGATAGGTT418010.3520421874569695No Hit
CCTGTCTGAGGGTCGCTT414870.34939772328478497No Hit
TTCACGTAATCCAGGATAGGCT412480.3473848986441731No Hit
AAGCTGCCAGCTGAAGAACT401840.33842403915626096No Hit
TACCCTGTAGATCCGGATTTGT328540.27669180227055046No Hit
TTCACAGTGGCTAAGTTCAGT322240.2713860302053393No Hit
TTCAGTCATTGTTTCTGGTTGT316200.26629922651107335No Hit
CATTGCACTTGTCTCGGTCTGA314260.26466538558940517No Hit
CACCACGTTCCCGTGG312090.26283784187805465No Hit
TGAGATGAAGCACTGTAGCTC309910.2610018763062832No Hit
GCATCGATGGTTCAGTGGTAGAATGC308170.25953647259303436No Hit
ACCCTGTAGAACCGAATTTGTG306350.25800369399641787No Hit
TGAGGTAGTAGTTTGTGCTGTT305820.2575573353941064No Hit
TTTGGTCCCCTTCAACCAGCTG268250.2259164057925219No Hit
TGATGTAGTAGGTTGTATAGTT258700.21787352909049548No Hit
TAGCTTATCAGACTGGTGTTGG258600.2177893104862858No Hit
TTCACAGTGGTTAAGTTCTGCC258160.21741874862776311No Hit
TGTAAACATCCTACACTCTCAGCT255490.2151701118953641No Hit
TACCCTGTAGAACCGAATGTGT246370.2074893751914394No Hit
TACCCTGTAGAACCGAATTTGTG233470.19662517524838805No Hit
TGTAAACATCCCCGACTGGAAGCT224810.18933184412382795No Hit
TACCATGTAGAACCGAATTTGT222270.18719269157690155No Hit
GAAGGATCATTA214440.180598374867282No Hit
ACCACGTTCCCGTGG212830.17924245533950584No Hit
TTCAAGTAATCCAGGATAGGC210580.17734753674478757No Hit
TACCCTGTAGATCCGGATTTGTG208730.1757894925669081No Hit
TTCACAGTGGTTAAGTTCTGC208570.1756547428001726No Hit
AACATTCAACGCTGTCGGTGAGTT207110.17442515117871094No Hit
TACGCCTGTCTGAGGGTCGCT204840.17251338886315076No Hit
CTGGACAACTCTTAGCGG203120.1710648288707439No Hit
TTCAAGTAATCCAGGATGGGCT194510.16381360704828868No Hit
TCCTTCATTCCACCGGAGTCT193130.1626513903101948No Hit
ACATTAGTCTGCACATTGGTT192920.16247453124135444No Hit
TATTGCACTTGTCCCGGCCTGTT190540.16047012846116354No Hit
TGAGGTAGTAGATTGAATAGTT186860.1573708838262466No Hit
AGCTACATCTGGCTACTGGGTCTC185100.15588863639215583No Hit
CCCAGTGTTCAGACTACCTGTTC183070.15417899872669893No Hit
CATTATTACTTTTGGTACGCG182970.15409478012248923No Hit
CACGTTCCCGTGG182860.15400213965785856No Hit
TCCCTGAGACCCTTAACCTGTGA181310.1526967512926082No Hit
AACATTCATTGCTGTCGGTGGGTT177900.1498248968890574No Hit
TCCAGCATCAGTGATTTTGTTG176220.14841002433833442No Hit
TGGACGGAGAACTGATAAGGGC175600.1478878689922343No Hit
TGAGGTAGTAGGTTGTATAGT174970.14735729178571316No Hit
AACCCGTAGATCCGAACTTGTG171860.14473809319479147No Hit
TGAGGTAGTTGGTTGTATAGTT168960.14229575367271016No Hit
AAGTTCTGTGATACACTCAGACT167610.1411588025158792No Hit
TTTTGTCCCCTTCAACCAGCTGT161250.13580249928814225No Hit
TGAGATGAAGCACTGTAGCTCT159600.1344128923186822No Hit
TACCCTGTAGAACCGAATTTG157670.13278747325743495No Hit
TTGTTCCCCTTCAACCAGCTGT156130.1314905067526056No Hit
TCCCTGAGACCCTTAACCTGTG153740.12947768211199373No Hit
CTACGCCTGTCTGAGGGTCGCTT149940.1262773751520251No Hit
ACCACAGGGTAGAACCACGGAC147560.12427297237183424No Hit
AAGTTCTGTGATACACTTTGACT142810.12027258867187345No Hit
TTCAAGTAATCCAGGATAGGCTT139120.11716492217653551No Hit
ACCCTGTAGAACCGAATTTGTGT131410.11067166779196759No Hit
ACTGGACAACTCTTAGCGG130340.10977052872692379No Hit
TTAGGTAGTAGGTTGTATAGTT129670.10920626407871878No Hit
TCACAGTGAACCGGTCTCTTT129360.10894518640566872No Hit
TGAGAACTGAATTCCATAGATGG128910.10856620268672507No Hit
AACATTCAACGCTGTCGGTGG125740.10589647293327756No Hit
TGAGGTAGTAGGTTGTATAGTTT121560.10237613527731208No Hit
TGAGGTAGTTGGTTGTATTGTT121430.10226665109183947No Hit
TAGCAGCACGTAAATATTGGAG119940.10101179388911491No Hit
TGTAAACATCCCCGACTGGAAGC118800.10005170180112434No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TGGCCTC50.0044620261354.383823
CGGGCGA50.0044620261354.383823
GAGCGCA500.01218.945323
CAACCCG5450.01118.298523
TAACTGC3400.01075.540223
GATTCCT10200.0975.95323
TAACTAA1200.0959.355223
AATAACC1050.0838.428123
GTGTGCT700.0773.933623
ACGCACT700.0677.191923
GAGTCCC1000.0609.4726623
AATGCTC49550.0557.047522
CGAGGTC251.3685798E-4541.753523
ACAACCC12950.0535.090222
ATAACTA6950.0529.807222
ACACACT2400.0479.677623
CACGTGT1150.0471.0900323
TTGGGTA754.1836756E-11451.4612723
CCACACC302.363598E-4451.4612723
ATGACCG900.0451.4612423