FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_5_JM94_5_CAACTA_L004_R1_001_TRIMMED_prinseq_good_yPPa.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_5_JM94_5_CAACTA_L004_R1_001_TRIMMED_prinseq_good_yPPa.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11436605
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGT8048167.037193292939644No Hit
AACATTCAACGCTGTCGGTGAG7250586.3398010161232285No Hit
TTCAAGTAATCCAGGATAGGCT5184714.533434528865865No Hit
TAGCTTATCAGACTGGTGTTGGC4363363.8152581120008953No Hit
TCCTTCATTCCACCGGAGTCTG3430812.9998500429104618No Hit
CCTGTCTGAGGGTCGCT2757512.4111263788510664No Hit
TACCCTGTAGAACCGAATTTGT2518522.202157021248876No Hit
AAGCTGCCAGCTGAAGAACTGT2259281.9754813600714547No Hit
TGAGGTAGTAGGTTGTATAGTT1520671.3296515880368345No Hit
TATTGCACTTGTCCCGGCCTGT1506701.3174364245333297No Hit
ACAGTAGTCTGCACATTGGTT1331141.1639293304262934No Hit
AACATTCAACGCTGTCGGTGA1272981.1130750777875076No Hit
AACAGTAAGAGTTTATGTGCTG1157071.0117250705082494No Hit
TTGGTCCCCTTCAACCAGCTGT1111280.971686964794185No Hit
TCCTTCATTCCACCGGAGTCTGT1106140.9671926240348424No Hit
TACCCTGTAGAACCGAATTTGCG1039790.9091771552834079No Hit
TTTGGTCCCCTTCAACCAGCTGT924280.8081769021488457No Hit
TAACGGAACCCATAATGCAGCTG843230.7373079685798365No Hit
CTGTCTGAGGGTCGCT787590.6886571670526349No Hit
CTACGCCTGTCTGAGGGTCGCT779850.681889424352769No Hit
TACCCTGTAGAACCGAATTTGC760730.6651711762363044No Hit
TTCACAGTGGTTAAGTTCTG708610.619598211182427No Hit
TTCCCTTTGTCATCCTATGCCT707960.619029860697296No Hit
TTCACAGTGGCTAAGTTCTG602130.526493657864375No Hit
TTCAAGTAATCCAGGATAGGTT590520.5163420438145762No Hit
AACATTCATTGCTGTCGGTGGGT573160.5011627139347735No Hit
TTCACAGTGGCTAAGTTCTGC543490.47521970025195415No Hit
AACATTCATTGCTGTCGGTGGG501890.4388452692035792No Hit
TATGTGCCCTTGGACTACATCG466080.4075335293996776No Hit
ACAGTAGTCTGCACATTGGTTA457190.39976024353381095No Hit
AAGCTGCCAGCTGAAGAACTGC453280.39634139676940844No Hit
CACCACGTTCCCGTGG450610.39400678785356313No Hit
ACCCTGTAGAACCGAATTTGCG449440.3929837569803276No Hit
TGTCTGAGGGTCGCT439840.3845896575076257No Hit
TGAGGTAGTAGTTTGTATAGTT434870.380243962259779No Hit
TACAGTAGTCTGCACATTGGTT419070.3664286735442905No Hit
CCACGTTCCCGTGG404360.35356646487309823No Hit
AAGCTGCCAGCTGAAGAACT395730.3460205192012839No Hit
TTCACAGTGGCTAAGTTCAGT377570.3301416810320895No Hit
CCTGTCTGAGGGTCGCTT365880.3199201161533515No Hit
TTCACAGTGGTTAAGTTCTGCC361690.31625644148766174No Hit
ATGACCTATGAATTGACAGCC330840.2892816530779895No Hit
TTAGGTAGTAGGTTGTATAGTT311290.2721874192559768No Hit
GCATCGATGGTTCAGTGGTAGAATGCTC304700.2664252197221116No Hit
TGTAAACATCCTTGACTGGAAGCT298570.2610652374546467No Hit
TTCAGTCATTGTTTCTGGTTGT288850.25256621173853605No Hit
TGAGATGAAGCACTGTAGCTC285490.24962827692309036No Hit
ATGACCTATGAATTGACAGCCA281320.2459820899646355No Hit
GCATCGATGGTTCAGTGGTAGAATGC278150.24321028836792039No Hit
TACCCTGTAGATCCGGATTTGT277190.2423708784206502No Hit
TAGCTTATCAGACTGGTGTTGG273840.2394416874588219No Hit
TTCAAGTAATCCAGGATAGGC264590.23135362286272892No Hit
ACCACGTTCCCGTGG257920.22552147249992457No Hit
TTCACAGTGGTTAAGTTCTGC256090.22392134728794078No Hit
CATTGCACTTGTCTCGGTCTGA245290.21447798538115115No Hit
AACATTCAACGCTGTCGGTGAGTT226310.19788215121533007No Hit
TACGCCTGTCTGAGGGTCGCT215640.18855245940556659No Hit
AACATTCATTGCTGTCGGTGGGTT215550.18847376472301003No Hit
TTCACGTAATCCAGGATAGGCT214920.18792290194511396No Hit
TCCTTCATTCCACCGGAGTCT211920.18529974585989462No Hit
TGAGGTAGTAGTTTGTGCTGTT210730.18425922727942426No Hit
CACGTTCCCGTGG206440.1805081140775606No Hit
CCTTTCTGAGGGTCGCT204480.17879431876855065No Hit
ACCCTGTAGAACCGAATTTGTG202060.17667830619314037No Hit
AGCTACATCTGGCTACTGGGTCTC201620.17629357663397485No Hit
TTCAAGTAATCCAGGATGGGCT201380.1760837241471573No Hit
TCCCTGAGACCCTTAACCTGTGA200800.17557658063734824No Hit
AACCCGTAGATCCGAACTTGTG198550.17360921357343373No Hit
TGGACGGAGAACTGATAAGGGC189050.1653025526369058No Hit
TACCCTGTAGATCCGGATTTGTG187530.16397348688706131No Hit
TAGCAGCACGTAAATATTGGAG187410.16386856064365254No Hit
TACCCTGTAGAACCGAATGTGT183180.16016991056349328No Hit
TGAGGTAGTAGATTGAATAGTT183040.1600474966128497No Hit
AACATTCAACGCTGTCGGTGG179300.15677729535994292No Hit
ACCACAGGGTAGAACCACGGAC174890.15292125591467048No Hit
TTCAAGTAATCCAGGATAGGCTT174040.15217802835719169No Hit
AACATTAAGAGTTTATGTGCTG173240.15147852006779983No Hit
TGTAAACATCCTACACTCTCAGCT172280.15063911012052963No Hit
CATTATTACTTTTGGTACGCG171740.15016694202519015No Hit
TACCCTGTAGAACCGAATTTGTG164270.143635283372994No Hit
TCACAGTGAACCGGTCTCTTT163930.14333799235000247No Hit
AACATTCAACGCTGTCGGTGAGA162040.14168540401631427No Hit
CTGGACAACTCTTAGCGG161620.14131816216438356No Hit
TTTGGTCCCCTTCAACCAGCTG160750.14055744689966998No Hit
TATTGCACTTGTCCCGGCCTGTT158120.13825781339829435No Hit
AATATTCAACGCTGTCGGTGAGT157120.13738342803655454No Hit
TATTTCACTTGTCCCGGCCTGT156290.13665768818631052No Hit
TCCAGCATCAGTGATTTTGTTG151870.1327929048874207No Hit
TGTAAACATCCCCGACTGGAAGCT150760.13182233713588953No Hit
TGAGATGAAGCACTGTAGCTCT149190.13044955211795808No Hit
AAGTTCTGTGATACACTCAGACT145580.12729302096207748No Hit
TTCCCTTTGTCATCCTATGCCTG141810.12399658814831849No Hit
CCCAGTGTTCAGACTACCTGTTC139730.12217786659589976No Hit
TCCCTGAGACCCTTAACCTGTG138050.1207088991881769No Hit
AATATTCAACGCTGTCGGTGAG137190.1199569277770807No Hit
TGAGAACTGAATTCCATAGATGG133930.11710643149780901No Hit
AAGTTCTGTGATACACTTTGACT129950.11362637775808467No Hit
TGAGGTAGTAGGTTGTATAGT126990.11103819708733492No Hit
TACCCTGTAGAACCGAATTTG125020.10931565792470756No Hit
CCAGTCTGAGGGTCGCT123000.1075493994939932No Hit
TAACTGAACCCATAATGCAGCTG117880.1030725464418855No Hit
TATCTTATCAGACTGGTGTTGGC117150.10243424512781547No Hit
CAGTAGTCTGCACATTGGTT116660.10200579630056297No Hit
TTCACAGTGGCTAAGTTCTGCT114680.10027451328431819No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTGC2950.01980.604723
GATTCCT7900.01908.149823
CAACCCG1500.01869.690923
AATAACC650.01797.779723
TAACTAA1000.01635.979623
ACGCACT650.01618.001723
GAGCGCA450.01558.075823
TCGCCGT100.00599180441168.556823
ACGGCTA100.00599180441168.556823
TCTCACA100.00599180441168.556823
GATTCGC100.00599180441168.556823
TATACCC100.00599180441168.556823
CCGCACT100.00599180441168.556823
CTTACAA100.00599180441168.556823
GTGTGCT1050.0890.328923
AATGCTC48900.0853.933722
ATAACTA5750.0846.6034522
ACAACCC5900.0832.6492322
TCTGACT31250.0830.142823
GAGTCCC604.820322E-10779.0378423