FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_5_JM95_5_CACCGG_L005_R1_001_TRIMMED_prinseq_good_R3NH.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_5_JM95_5_CACCGG_L005_R1_001_TRIMMED_prinseq_good_R3NH.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13849408
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG8373386.046020162017034No Hit
TTCAAGTAATCCAGGATAGGCT8175915.90343645013563No Hit
AACATTCAACGCTGTCGGTGAGT7836865.658624541929879No Hit
TACCCTGTAGAACCGAATTTGT3765332.718766029566029No Hit
TCCTTCATTCCACCGGAGTCTG3733352.6956747898538334No Hit
CCTGTCTGAGGGTCGCT3571062.578492885760893No Hit
TGAGGTAGTAGGTTGTATAGTT3476982.5105621843186365No Hit
TAGCTTATCAGACTGGTGTTGGC3206822.3154924744797754No Hit
AAGCTGCCAGCTGAAGAACTGT2959562.136957767436702No Hit
AACAGTAAGAGTTTATGTGCTG2211921.5971224185178168No Hit
TATTGCACTTGTCCCGGCCTGT2033631.4683876740435404No Hit
ACAGTAGTCTGCACATTGGTT1900931.3725713041308336No Hit
AACATTCAACGCTGTCGGTGA1797111.2976078111064386No Hit
TTGGTCCCCTTCAACCAGCTGT1556011.1235209476101795No Hit
TACCCTGTAGAACCGAATTTGCG1553751.1218891089063159No Hit
TTTGGTCCCCTTCAACCAGCTGT1428981.0317986155076087No Hit
TCCTTCATTCCACCGGAGTCTGT1405321.014714852793708No Hit
TACCCTGTAGAACCGAATTTGC1381770.9977105158574288No Hit
TTCCCTTTGTCATCCTATGCCT1309480.9455133389095044No Hit
TAACGGAACCCATAATGCAGCTG1216420.878319131041558No Hit
TTCACAGTGGTTAAGTTCTG1181090.8528090153745199No Hit
CTACGCCTGTCTGAGGGTCGCT1077410.7779466097034617No Hit
CTGTCTGAGGGTCGCT947660.6842602947360639No Hit
TGAGGTAGTAGTTTGTATAGTT894310.645738792589546No Hit
TTCACAGTGGCTAAGTTCTG886450.6400634597522147No Hit
TGTCTGAGGGTCGCT801040.5783929536915946No Hit
TTCAAGTAATCCAGGATAGGTT723560.5224483241449743No Hit
TTCACAGTGGCTAAGTTCTGC708430.5115236694593733No Hit
ACCCTGTAGAACCGAATTTGCG614000.443340249633775No Hit
TACAGTAGTCTGCACATTGGTT609390.44001158749890246No Hit
TATGTGCCCTTGGACTACATCG594380.4291735791161615No Hit
AAGCTGCCAGCTGAAGAACT564000.40723762344209946No Hit
ACAGTAGTCTGCACATTGGTTA561710.4055841231625207No Hit
TTCACAGTGGCTAAGTTCAGT555760.40128791064571134No Hit
AAGCTGCCAGCTGAAGAACTGC514300.3713516130075741No Hit
CCACGTTCCCGTGG513950.37109889462423234No Hit
CCTTTCTGAGGGTCGCT471540.34047664708845315No Hit
TTCAAGTAATCCAGGATAGGC454820.32840392888995684No Hit
AACATTCATTGCTGTCGGTGGGT452090.3264327254998914No Hit
TTCAGTCATTGTTTCTGGTTGT451630.326100581338928No Hit
ATGACCTATGAATTGACAGCC445600.32174660462021193No Hit
TACCCTGTAGATCCGGATTTGT441100.31849736826296116No Hit
TTCACAGTGGTTAAGTTCTGCC439470.31732042264911253No Hit
TAGCTTATCAGACTGGTGTTGG437750.31607849230811885No Hit
AACATTCATTGCTGTCGGTGGG437460.31586909707620714No Hit
TGAGATGAAGCACTGTAGCTC416530.30075653775237177No Hit
CACCACGTTCCCGTGG415590.3000778083799683No Hit
TGAGGTAGTAGGTTGTATAGT412370.2977527992532244No Hit
CATTGCACTTGTCTCGGTCTGA397910.2873119197585918No Hit
TGTAAACATCCTTGACTGGAAGCT394270.28468364857183787No Hit
ATGACCTATGAATTGACAGCCA379160.2737734349367135No Hit
TTCACAGTGGTTAAGTTCTGC366850.26488496836832304No Hit
TCCTTCATTCCACCGGAGTCT364250.26300763180635595No Hit
TGAGGTAGTAGATTGAATAGTT332200.2398658484174919No Hit
TCCAGCATCAGTGATTTTGTTG323180.23335293465251367No Hit
TGAGGTAGTAGGTTGTATAGTTT317870.22951883575095772No Hit
TTCAAGTAATCCAGGATAGGCTT308160.22250770574453435No Hit
TGAGATGAAGCACTGTAGCTCT304470.21984333193158873No Hit
TATTGCACTTGTCCCGGCCTGTT294190.21242063198658023No Hit
CCTGTCTGAGGGTCGCTT277790.20057897059571067No Hit
TGAGGTAGTAGTTTGTGCTGTT276460.1996186407390121No Hit
CACGTTCCCGTGG275220.19872329560945853No Hit
TTTGGTCCCCTTCAACCAGCTG269150.19434043678978913No Hit
ACCCTGTAGAACCGAATTTGTG268030.1935317379630956No Hit
AACCCGTAGATCCGAACTTGTG262980.18988537271773637No Hit
TGTAAACATCCTACACTCTCAGCT252640.18241934962129788No Hit
TGGACGGAGAACTGATAAGGGC251480.18158176869365103No Hit
TACGCCTGTCTGAGGGTCGCT246990.17833975286163856No Hit
ACATTAGTCTGCACATTGGTT243600.17589199480584294No Hit
CATTATTACTTTTGGTACGCG239270.17276550737764387No Hit
TTCAAGTAATCCAGGATGGGCT223210.16116934384487772No Hit
ACCACGTTCCCGTGG218600.15784068171000523No Hit
TGAGGTAGTTGGTTGTATAGTT216010.15597056567327644No Hit
TTCCCTTTGTCATCCTATGCCTG215500.15560231888612136No Hit
TCCAGCATCAGTGATTTTGTT212660.1535516897184342No Hit
TACCCTGTAGAACCGAATTTG211690.15285129877031567No Hit
TGTAAACATCCCCGACTGGAAGCT211660.15282963719460066No Hit
AACATTCAACGCTGTCGGTGAGA210010.15163825053027538No Hit
TACCCTGTAGATCCGGATTTGTG205080.14807853158777617No Hit
TCCCTGAGACCCTTAACCTGTG203260.14676439599439917No Hit
TCCCTGAGACCCTTAACCTGTGA201530.14551524512816721No Hit
TACCCTGTAGAACCGAATGTGT199700.14419388900955188No Hit
AACATTCAACGCTGTCGGTGG198500.1433274259809517No Hit
AGCTACATCTGGCTACTGGGTCTC197360.14250428610378146No Hit
TTCCAGTGATGACAGCCTATAATCTGACT196530.14190498250899966No Hit
TAGCAGCACGTAAATATTGGAG193050.13939223972605905No Hit
TTGTTCCCCTTCAACCAGCTGT191170.13803478098125205No Hit
TCACAGTGAACCGGTCTCTTT187550.13542095084497474No Hit
GAAGGATCATTA187320.13525487876449305No Hit
TACCCTGTAGAACCGAATTTGTG187150.13513212983544134No Hit
TGAGAACTGAATTCCATAGATGG185710.13409237420112108No Hit
TGAAATGTTTAGGACCACTTGT178570.12893691918094982No Hit
TGAGATGAAGCACTGTAGCT175190.12649638165039256No Hit
TGATGTAGTAGGTTGTATAGTT171120.12355762787839017No Hit
CAGTAGTCTGCACATTGGTT171020.12348542262600683No Hit
CCCAGTGTTCAGACTACCTGTTC170900.1233987763231468No Hit
TACAGTACTGTGATAACTGAAG169310.12225071281025152No Hit
GTGAAATGTTTAGGACCACTTG168880.12194023022500312No Hit
ACCACAGGGTAGAACCACGGAC167120.12066941778305613No Hit
AATGACACGTTTTCTCCCGGATT162440.11729021197151532No Hit
TGTAAACATCCCCGACTGGAAGC159080.11486411549143472No Hit
TCCCTGAGACCCTAACTTGTGA156970.11334058466614602No Hit
TTCACAGTGGCTAAGTTCTGCT155160.11203366959800737No Hit
GTGAAATGTTTAGGACCACT154230.1113621607508422No Hit
CCCAGTGTTCAGACTACCTGTT154120.11128273497322053No Hit
TTCACAGTGGTTAAGTTCTGCCT153860.1110950013170238No Hit
TCCAGTGATGACAGCCTATAATCTGACT153850.11108778079178547No Hit
AACATTCAACGCTGTCGGTGAGTT153840.11108056026654714No Hit
TAATACTGTCTGGTAATGCCG151130.10912379792695832No Hit
AAGTTCTGTGATACACTCAGACT145630.105152509045874No Hit
TAACACTGTCTGGTAACGATGT144470.10431492811822714No Hit
TTTTGTCCCCTTCAACCAGCTGT144200.1041199739367921No Hit
AAGTTCTGTGATACACTTTGACT143850.10386725555345036No Hit
TATTGCACTTGTCCCGGCCTGTA142440.10284916149484512No Hit
TTATGTAGTAGGTTGTATAGTT139820.10095738388240132No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCCCACA50.00212157451964.230723
CATATTT50.00212157451964.230723
TAACTGC2550.01617.601823
CAACCCG3250.01601.603623
GATTCCT6750.01440.435923
TAACTAA900.01418.611223
AATAACC1150.01281.020123
TCGGATA305.912807E-8982.1153623
GAGCGCA401.5097612E-10982.1153623
GTCCATC100.008483421982.1153623
AAGGTAC50.008704789969.655422
ATGTATC50.008704789969.655422
ATAACCA50.008704789969.655422
ATAACTA10250.0946.0052522
ATCACTA850.0912.616822
ACAACCC7900.0896.010722
AATGCTC2300.0864.2580622
ACGCGCT351.09495886E-7841.8132323
TCTGACT53350.0754.765323
GGATTCC9850.0718.6278722